SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03266
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.13
 

Sequence

CDS
ATGCCTGCCGCTCCCGCGTCGCCTATACTAGTGGGTAAAACTGCTGCGTCGTCCGCCGTGGTCGCCGCTCCCCTGGCGCGATCATCCGCGGGTTCAGTAGGGTCCGACGGACATCCTGCATCTGCCCGTAGGTCGCCTGCTCCCGAGCCTGCTGCCTCCTCGTCCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCGCCGCCTCATCGACGGATGGATTCACCCTGGTACAAAAGGGTAAGAAGCGCGCTGCGGAGTCCCGAGCTCCCGCGGCCGCTAAAATTAGTAAAGCCGCGAACGCGTCGCGCCCTCGCCCTCCGACTCCCGTCGCTCCCCCTGCCCGTGCCACACCGTCGCCGCGTCCAGTGGCACAAAATAAAACTCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGACCGAGTTTCCCTGGCCCTTCAGGCCAAAAAAATTAATTTTATCAGCGCCCGTAACCTCGCGAACGGGATTCAAATTAAGGTAACGACACCCGACGACCATAGGGCCCTCTCAAGCTACCTCCGAAAGGAGCGTATAAGTTTCCACACTTATACGCTTCAGGAGGAGCGTGAACTTCGCGCGGTCATACGCGGCATCCCAAAGGAATTAGATGCCGATCTCGTCAAGGCCGACCTTCTAGAACAAGGTCTGCCGGAGACCCTGCTTAAGCCCGCGCGCCGCGACCCTAAAATCGCGAACTACAACATGGTTAGGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCACTCGACCCCCCCGCGCTTTCTAACATCGAAGCATCAGTATGCCGAATCTCACTGACTGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAAATTGTTCTAAGTAGTGATATTGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGTGACCTAAATTGTAAACACGTCAGGTGGAACTCTCACACCTCAACCCCTAATGGCAGGCGCCTCGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTGACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCGGCGCTTACATTCGATTGAAGTAGTTTCAGAGTTAGATTCAGACCATCGTCCCGTCATTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCATCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTTCCGTTTAGTCTGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCGTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGTGCGTACGATAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAGCCCAGTGCATGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTTGGACGCGTTACCGCCCGTCACCTCAATGGAAGTTAAAGACCTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTTTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCACTATGGCTAACTGTATCTTTCCCACGGTATGGAAAGAAGCGGACGTTATCGGCATACACAAACCCGATAAACCAAAAAACAATCCGACCAGTTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGACTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCAAAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGGCTGGAGTGCCGCAAGGCTCCGTTCTCTCACCGCTCCTATTTAGTTTATTTATTAATGATATTCCCCGGTCGCCGCCGACCCAGCTAGCCTTATTCGCTGACGACACAACCGTTTACTACTCAAGTAGAAACAAGTCCCTAATCGCGAGTAAACTCCAGAGCGCAGCGTTAGCCCTCGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCGGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACTCCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGGTCAGGAAGGTTAAGTACCTGGGAGTCACCCTGGATGCATCCATGACATTCCGCCCACACATAAAAACAGTCCGCGACCGTGCCGCATTCATTCTCGGCAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCATCATGACTTATGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTTGAATCAATCCAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCACCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGAGCAGGCTTAGGGACCCCAGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAG
Protein
MPAAPASPILVGKTAASSAVVAAPLARSSAGSVGSDGHPASARRSPAPEPAASSSSDSDSDMEVDLAAASSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPPTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVSLALQAKKINFISARNLANGIQIKVTTPDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELDADLVKADLLEQGLPETLLKPARRDPKIANYNMVRNDRLTARGGGTVIYYRRALHCVPLDPPALSNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHVRWNSHTSTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTRRLHSIEVVSELDSDHRPVIMKLGRAPDSVPITRTVVDWHTLGISLAESDPPSLPFSLDSIPSPQDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDSSYSQIGYGSNYAPLVGPSGRLAAFDDDEKAELLADTLQAQCMPSIQSADPVHVELVDSEVERRASLPPLDALPPVTSMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNATMANCIFPTVWKEADVIGIHKPDKPKNNPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWQNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFINDIPRSPPTQLALFADDTTVYYSSRNKSLIASKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWVRKVKYLGVTLDASMTFRPHIKTVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPIMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDPSNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02034467    GGMS01006359    MBY75562.1    ABLF02023911    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFTR01008251    JAW08175.1    GFTR01008256    JAW08170.1    NEVH01020940    PNF20481.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GFTR01008257    JAW08169.1    GFXV01000908    MBW12713.1    GGFL01004957    MBW69135.1    GGMR01000676    MBY13295.1    GGFL01005012    MBW69190.1    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    ABLF02041767    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    KK119261    KFM75202.1    GGMR01016905    MBY29524.1    GBGD01000415    JAC88474.1    RPOV01000134    RPJ78669.1    GGMR01006491    MBY19110.1    GFTR01008151    JAW08275.1    GGFJ01001822    MBW50963.1    GEZM01084969    JAV60363.1    GGMR01012676    MBY25295.1    DNOY01000259    HBE18313.1    S59870    AAB26437.2    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GFTR01008246    JAW08180.1    AF456125    AAL57609.1    GECL01003538    JAP02586.1    GGMR01012443    MBY25062.1    AY180919    AAN87272.1    GGMR01016296    MBY28915.1    GBBI01003747    JAC14965.1    ABLF02014118    ABLF02014121    ABLF02054790    CP012527    ALC48130.1    GFDL01000006    JAV35039.1    NNAY01003095    OXU19992.1    M22874    M38643   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1097
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.756619999999999
Exp number, first 60 AAs:
0.01808
Total prob of N-in:
0.00094
outside
1  -  1097
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
21.340928
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号