SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03255
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.198 Mitochondrial   Reliability : 1.27
 

Sequence

CDS
ATGCACGCATTCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCGGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCTGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGTGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCAACATTGTGATTACGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTTGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGGACGGGGGCCAGGGAGGCGGATCTCGGCCAAGCCCTGGCCCTCTAA
Protein
MHAFRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRAGGVARPSPSVVRARRAQSLRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGVFLHRITAEPTAECQHCDYDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRTGAREADLGQALAL

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    LBMM01009501    KMQ88083.1    + More
KZ150386    PZC71062.1    KZ150308    PZC71477.1    KZ149950    PZC76665.1    KZ149896    PZC78733.1    AB078935    BAC06462.1    LBMM01006538    KMQ90523.1    AB078931    BAC06456.1    AB078930    BAC06454.1    AB078929    BAC06452.1    LBMM01016102    KMQ84557.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01012027    KMQ86470.1    LBMM01003679    KMQ93242.1    QOIP01000009    RLU18544.1    LBMM01008861    KMQ88580.1    ODYU01009945    SOQ54696.1    LBMM01009494    KMQ88097.1    KZ149918    PZC77857.1    D85594    BAA19776.1    LBMM01014132    KMQ85305.1    ODYU01005282    SOQ45985.1    KQ460685    KPJ12887.1    LBMM01005733    KMQ91252.1    LBMM01024024    KMQ82631.1    QOIP01000031    RLU14697.1    LBMM01006954    KMQ90166.1    LBMM01008682    KMQ88705.1    GL450953    EFN80213.1    LBMM01006657    KMQ90417.1    QOIP01000007    RLU20280.1    QOIP01000010    RLU18098.1    LBMM01004272    KMQ92618.1    ABLF02006132    LBMM01006671    KMQ90407.1    QOIP01000002    RLU25407.1    LBMM01019838    KMQ83439.1    LBMM01005634    KMQ91349.1    LBMM01019839    KMQ83438.1    LBMM01006110    KMQ90925.1    LBMM01006725    KMQ90373.1    LBMM01006662    KMQ90413.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    LBMM01004152    KMQ92762.1    QOIP01000003    RLU25053.1    LBMM01011877    KMQ86578.1    LBMM01009472    KMQ88117.1    LBMM01015018    KMQ84954.1    LBMM01007036    KMQ90099.1    LBMM01008349    KMQ88951.1    GGMR01011974    MBY24593.1    LBMM01014909    KMQ85000.1    LBMM01015025    KMQ84953.1    ABLF02011238    LBMM01004634    KMQ92224.1    LBMM01006640    KMQ90440.1    ABLF02031781    ABLF02031788    LBMM01020326    KMQ83308.1    CH963857    KRF98317.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00732   GMC_oxred_N
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF56219   SSF56219        + More
SSF51905   SSF51905       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
224
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14369
Exp number, first 60 AAs:
0.06549
Total prob of N-in:
0.13507
outside
1  -  224
 
 

Population Genetic Test Statistics

Pi
159.139291
Theta
62.175465
Tajima's D
-1.093824
CLR
0
CSRT
0.120993950302485
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号