SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03235  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013590
Annotation
PREDICTED:_DNA_replication_licensing_factor_Mcm3_isoform_X1_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.623
 

Sequence

CDS
ATGGATAAATACAATCCAGATACATTCAGAATTGACGATTACATTGATTTTTTCGAAAACAAATGCAAAATTCTTGATATCGATAACAGCGACTTACAGAAAGATTTGCTTCTGAATTTACTAACACCAGAGATATTCCACGAATTAAAAGTAGCTTTAACGCCTGATTTCGATATAGCTACATACAGCGAAATTTGTAACAAATTATTAGACCTCTATCGCATAAAAACGACGAGGTATAGAGCCTTAACAGAATTTTGGAATTGCACTAGAGAACAAAATGAAACGATGGAACACTATGCAAACAGATTAAAAGGTCTTAGTCGGGATTGTGGCTACACTAATGATTTCCTGGAACGACAATTACGTGACCGCTTTGCCACTGGATTGAATCATCCAGATTTAGAAACCGACTTGAAACAAAAATGGCCTGATTTAGTTCAAATGGTAGACGGAATACCACGAGAAGCCCATAAAGCCAAATTAGCAGCTCAGTCCCGCGCACCGCTCGCCGCCGCCGCGAATATCCCAGACTCGCCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATAGCGTCCTGCGCGGCATCGAGCTCCGGCTCCGACTCCGAGTCGGAGATGGAGTTCGAGTCGGCCGCCAGCCCCGAACCCGGAACCTCCGATGGGTTCCAAACCGTCACGCGCGGGAAAAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAACCCAAGGCCGCGAACGCGTCGCGGCCAAAAGTCGTGGTCTCTCCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGACCCCAACCCGCGTCCGTCCGCAAAATTCCCGCGCCGCCGCCGGTCATCTTGCGGGAAAAGTCGTCGTGGAACCGGGTATCCCAGGCCCTTACGGCCAACAAAATTAATTACTCCCAAGCGCGTAATCTCGCGCACGGGATACAAATTAAAGTCGCAACGCCGGGCGACCATAGGGCCCTCACTTCTTACCTCCGAAAGGAGAGCATAGGCTACCACACCTATGCACTCCAGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTACCTAAAGAGCTCGACGTCGAGCTAATCAAAGAAGATTTAATTAGGCAAACGTACCCGATTATAAGTGTGCACCGTATGCACAGCGGGCGCGATAAATTCGCATACAACATGGTTCTCGTCGCGCTGGAACCAACCGCCGAAGGCAAACGAATTGCCTCAAGCCTCCGCACCGTTTGCGGCTTATCCGGGGTCACCGTCGAGGCCCCATATAAAAAAGGCACTCCCGGGCAGTGCCACCGCTGTCAGTTATACGGCCACTCCGCGCGCAACTGCCACGCGCGCCCGCGGTGCGTAAAGTGCCTCGGCGACCACGCGACAGCCGACTGTTCGCGGGTCAAAGAGACAGCGACTGAACCACCGAGCTGTGTGCTCTGCCAGAAGCAGGGCCACACAGCCAACTACCGCGGATGCCCCAAGGCCCCGCGGAAGCGTCTGGCCAACGCGCCTCCAAAAACCGTCGGCCCTAAGACTTCGGCGCCCCGCGCGCCGAAACCTGCCTTCGTGCCGGCACCGGTGCCCACCGTCTCCGCGTGGGCAAAACCGCTGCCGCTCACGTTGGCAGGAAAGCCACCGGCACCCCAGCCCCTGCTCGCGCCGCGCCCCGCCCCCGCGCCCGGTCCCGCGCCTCGCCCCGGCCCCGCGCGGCCTGTCGTTAACGAATTCTCAATCGTGCGCGATTATATCGCCGCGATAAATATCGACCGCATGCGTGCGTTCGCCTACGCCATGCGCAGAGCGGTCACGGCCGAAGACCGCCTAAACGCGACGTTCGAGTACATCGACGTCATCGAGTCCGTCCAGCGCACGCTGCGCGATCAAGTATATGAGTTTCTCCGCGATAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGTTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACAAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACTTCACATTCGAAATATTCAACCCCCCGACCCCCACGTACTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCTTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAATCAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTTTACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGATAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAATAACCCCGCCCCCGCCGTTCGCCCAATCACGATGTACGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATCCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTACAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCTAAACACGTCATCTCGGATCCTCCTGATCCACTAACGGTGCTTTTAGCATGTGACGCTTCCGACAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAACCAATTGCTTTTGCTTCAAGGAAACTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATACATATTATGGGTGCACACCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAATCTATCAGAACAGTTACTTATGAAAACAACTTCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGATTACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTTGTGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACATCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGACCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAATCTATTTTACATGTCACATCATCTCCATATCATCCTCGGACAAATGGGCTGGCACAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTTTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGACGACAATTGAACTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGATTAATGCAGTATTTACAAGTAAAAGAAAACATTCGTACCACATCACCGAGTTACCGACCAAGTGACCAAGTATATATTAAAACACGCAATGATAAAATATGGGAACCAGCGGTAATTACATCCCGAAAACATAAATATTCATATATTGTTTCAACACCAGGAGGACTAGAAAAACGAAGACACGCTGATCACATCAGGCCACGCGAGTCCTCCACCTCAGAAACCCCGAGGAATGAAAGGGCGCATTCTTCTATGCTGCCGGCGACTGCTTCTCCAGACATTGGAATGGAAACAACAATTAACGAAAGGCTAACTAAAAACAAGAATTCAGCAGCAGTACCATTACCTACACCGCAGTCACCTACAAATGTACAAATTTCTCCAAATTCACCTTCACAGCATTCGAAGTTATACTCCTCACCTGCTCCGGTCTCCACTCCTGTGCCATTTGCTGCGCGTCGAACTAAGTTCAATATGGAGGAAGGTGATTTCGATCAACGTTTGAGAGACTTACAAAGGGAGTACCTCGAATTTCTTGACGATGGTGAAGATCAAGAAATTTATATGGAAAAAGTGAAACAGATGATAGAAGATAAATCAAAGCGCCTCTTAGTCAGCATCAATGACTTAAGGCGTAAAAGTCCTGAACGTGCCAAGAATTTACTAGAGAATGCCTTTGAAGAACAGATAGCATTCCAAAAGGCTTTAAAAGAATATGTGTCTTCGATAGACCCTACATATGCTAAAATTCAAGAGGAGTTTTTTGTGGCATTCTCAGGAAGTTTTGGTAACAAACATGTTACACCCCGAAGTTTGACATCTAGGTACCTCGGAAATCTAATCTGTGTGGAAGGCATAGTGACTAGAGTATCATTGGTTCGTCCTAAGGTGGTCAGAAGTGTACATTATTGTCCAGTTACCAAAAAAGTGATGGAAAGGAAATATACCGATCTAACTTCATTTGAAGCATTTCCCACCTCTGCTGTATACCCTACTAAGGATGATGAAGGCAATCCTCTAGAAACTGAATATGGACTTTCGCGGTACAAAGATCATCAGACCCTTACCGTTCAAGAGATGCCCGAACGGGCACCAGCTGGGCAACTGCCAAGAAGTGTAGATATTATATGTGATGATGATCTAGTAGACAAATGTAAACCAGGAGACCGGGTGCAGATTGTAGGGAACTATAGATGCCTGCCCAATAAGCAGGGAAGCTTTACTGCTGGAACATTCAGAACAATCCTTATAGCTAACAATATAACACAAATCAACAAGAATATGAACATGTCAATAAACAGGGAAGATGTTAAGATCTGTAAAAGACTCGCAAAGAGAAAGAATGTTGATATGTTTGAACTTATGAGCAAATCTTTAGCTCCGTCAATCCATGGTCATGATTATATCAAGAAAGCTATTTTGTGCTTATTGCTTGGAGGCATGGAGAAGGTACTGCCAAATGGTACAAGATTGCGAGGAGACATCAACGTTCTGCTAATCGGCGACCCATCAGTGGCGAAGTCCCAGCTGCTCCGCTACGTGGTGCAGACCGCGCCGCGCGCCATCACCACCACCGGCCGCGGCTCGTCCGGCGTCGGGCTCACGGCTGCCGTCACCACGGACCCGGAGACAGGCGACCGGAGGCTGGAAGCGGGCGCGATGGTGCTGGCGGACCGCGGCGTGGTGTGCATCGACGAGTTCGACAAGATGTCGGACATCGACCGCACCGCCATCCACGAGGTCATGGAGCAGGGCCGCGTCACCATCGCCAAGGCCGGCGTGCACGCCTCGCTCAACGCGCGCTGCTCCGTGCTGGCCGCCGCCAACCCCGTGCTCGGCAGGTATGATCAGTACAAAACGCCCATGGAGAACATCGGCCTGCAAGACTCGTTGTTGTCGCGTTTCGACTTGCTATTTGTGATGCTGGACATCGCCGACGCCGACCAAGATAATATGATCTCTGAACACGTTCTTAGGATGCACAGATATAGAAATCCAAAGGAACAAGACGGAGAAGTATTACCGATGGGATCACTAGTCGAAATGCTTTCCACCGAGAACCCTGACAATGATGAAGTTGATGATACAGCCGAATCCATTTACGAGAAATACGATCCTCTGCTCCACGGCAACACTCGCAGCAAGAAAGATCAGATCTTTAGCACCAAGTTCATGCGGAAGTACATAGACCTGGCTCGACTCATGAAGCCGAAACTGAGTCAGGAGGCGTGTGACGTCATCGCCGATGAGTACGCCCGGCTGAGGAACCAGGACATGATGGATAGCGACATGGCAAGAACGCAACCGGTGACCGCCCGCACGCTGGAGACGCTCATCCGGCTGTCGACTGCGCACGCCAAGTGCCGCCTCAGCTTCCAAGTCACGCACGACGACGCGTTGGCTGCCATACAGCTAGTGCAGTTTGCTTACTTTAAGAAGGTGTTAACAAAGGAGAAAGGTCGCAAGCGCCGGGCATCCACTGAGAACGAGGACGCAGCCTCTGACACCGAGCCTGCCCAACCGCGACCCAAGCGCACTAGGAAAACTCAAGAAGGTCAAGATCCATACGAGTTTTCGTCGGATGAAGAAATGGAGCCGGTGCTACGGGCAGCGAGGTCTTCTCAACCAGAACCGGAGCCGCACACATCCAGTTCCAAGAAGACTATTCTACCTGCCAGGCTAGCCCAGTTCAAGTCAGCCCTACACGAGCTGTTCAAGTCGGAGCGCGCTAACTCGCTTCCCCTCAGTCGCATTACGAAACATCTCGACGAGAAATACTCCCACGAGATCTTCGACTCGGCCGAGGTCCAAGCGGCATTGGATTCCATGACCAGTGACAACCAAGTTATGATGGCCGATGACATGGTTTTCTTAATATAG
Protein
MDKYNPDTFRIDDYIDFFENKCKILDIDNSDLQKDLLLNLLTPEIFHELKVALTPDFDIATYSEICNKLLDLYRIKTTRYRALTEFWNCTREQNETMEHYANRLKGLSRDCGYTNDFLERQLRDRFATGLNHPDLETDLKQKWPDLVQMVDGIPREAHKAKLAAQSRAPLAAAANIPDSPMSPPTPAPASIASCAASSSGSDSESEMEFESAASPEPGTSDGFQTVTRGKKRARAVEPSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPQPASVRKIPAPPPVILREKSSWNRVSQALTANKINYSQARNLAHGIQIKVATPGDHRALTSYLRKESIGYHTYALQEDRELRVVIRGVPKELDVELIKEDLIRQTYPIISVHRMHSGRDKFAYNMVLVALEPTAEGKRIASSLRTVCGLSGVTVEAPYKKGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATADCSRVKETATEPPSCVLCQKQGHTANYRGCPKAPRKRLANAPPKTVGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPLTLAGKPPAPQPLLAPRPAPAPGPAPRPGPARPVVNEFSIVRDYIAAINIDRMRAFAYAMRRAVTAEDRLNATFEYIDVIESVQRTLRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLFGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDFTFEIFNPPTPTYYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNNPAPAVRPITMYDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLACDASDKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLIHIMGAHRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTSKDHILTKVCQNLKTGWRESDYNPEMKPFYRNRTELSVENKILVRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAQRLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTTSPSYRPSDQVYIKTRNDKIWEPAVITSRKHKYSYIVSTPGGLEKRRHADHIRPRESSTSETPRNERAHSSMLPATASPDIGMETTINERLTKNKNSAAVPLPTPQSPTNVQISPNSPSQHSKLYSSPAPVSTPVPFAARRTKFNMEEGDFDQRLRDLQREYLEFLDDGEDQEIYMEKVKQMIEDKSKRLLVSINDLRRKSPERAKNLLENAFEEQIAFQKALKEYVSSIDPTYAKIQEEFFVAFSGSFGNKHVTPRSLTSRYLGNLICVEGIVTRVSLVRPKVVRSVHYCPVTKKVMERKYTDLTSFEAFPTSAVYPTKDDEGNPLETEYGLSRYKDHQTLTVQEMPERAPAGQLPRSVDIICDDDLVDKCKPGDRVQIVGNYRCLPNKQGSFTAGTFRTILIANNITQINKNMNMSINREDVKICKRLAKRKNVDMFELMSKSLAPSIHGHDYIKKAILCLLLGGMEKVLPNGTRLRGDINVLLIGDPSVAKSQLLRYVVQTAPRAITTTGRGSSGVGLTAAVTTDPETGDRRLEAGAMVLADRGVVCIDEFDKMSDIDRTAIHEVMEQGRVTIAKAGVHASLNARCSVLAAANPVLGRYDQYKTPMENIGLQDSLLSRFDLLFVMLDIADADQDNMISEHVLRMHRYRNPKEQDGEVLPMGSLVEMLSTENPDNDEVDDTAESIYEKYDPLLHGNTRSKKDQIFSTKFMRKYIDLARLMKPKLSQEACDVIADEYARLRNQDMMDSDMARTQPVTARTLETLIRLSTAHAKCRLSFQVTHDDALAAIQLVQFAYFKKVLTKEKGRKRRASTENEDAASDTEPAQPRPKRTRKTQEGQDPYEFSSDEEMEPVLRAARSSQPEPEPHTSSSKKTILPARLAQFKSALHELFKSERANSLPLSRITKHLDEKYSHEIFDSAEVQAALDSMTSDNQVMMADDMVFLI

Summary

Uniprot
ProteinModelPortal
PDB
5XF8     E-value=5.86765e-155,     Score=1412

Ontologies

Topology

Length:
2945
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.24777
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00001
outside
1  -  2945
 
 

Population Genetic Test Statistics

Pi
221.135075
Theta
161.890744
Tajima's D
1.21553
CLR
0.279217
CSRT
0.71676416179191
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
27530593 RFFATGTDSESESSSEDEPVVRA 100.00 2e-09
27530593 RGPVAGTPDESIISDEEEPPVARF 100.00 2e-09
27530593 RADLGSSDSEDEAAISDFRK 100.00 1e-06
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号