SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03230
Annotation
reverse_ribonuclease_integrase?_partial_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 2.447
 

Sequence

CDS
ATGGTTTTTACGATAAAATTTTTATCCCTACAAAAAACTGAACTGGAATACGAAGTCGCGATAAGAGGTGAGACCCCCGGTGCTACGGTGGCTGATCTTAGGAAACAGATTAGCAAATTAAGTCAATCTTTTCCTTCAGAAGATATATTATGTTCTCATCTCGAACCCCTAGATGATCTTCAAGCTGTTTTGGACTTGCTGAATAAAGTCAATGCAAGTCTCGAGTCAAGCCCTACTGATAAAAGTACATTATCGCGCATAGAAAATATTTTTCATCACCTTTATCATAGGATCAACAGAATAGTGGTTGATGAAGTAGAGAAGCCGCACTCTGCTTGTAGTAAATTTTTTAAAGAATCCTACGAAAAATTCCAGAAATTAAGCAAAAAGGCAGTTGACCCTCTATTAGTTTGTGTATCTAGTTCAGCATCTGCTTCTGTACCTGGCATTCAGGCACCAATTAATGTCGCTGTTACTTGTGATCGAGGTGTTACTTCAGAATTGAGTAGGCTGAAGTTCGATGGTAAATCATGTGTTCGATCTTTTATTCAACGTGTTTACGAATTTAGCGAGGCTCGTAGCATCCCCGACTCAAAACTTCTCTCATCTGCTACAGAAATATTTACAGATGATGCGCTGCATTGGTTCAGGAGTATTAAGGACCAGGTTTCATCTTGGGATGATCTTGTTGTTCTTTTAAAAAAAGATTTTGATAAAGCAGACTATGATTACCGTTTACTTGCTGAGATTCGTGCTAGGACTCAAGGGGAAACGGAAAATATTACGATATACTTAGCTATTCTCTCGGTTTCCGGCCTTTTGGATTCAGGCTCAGCGGTTACTATTTTAGGCAACAATGCTCATAGTGCATTAGTTAGTCGTGGGCTGGAGTTGTGTACTGATGATAAATTGACTATTATTGCGGCTGGTGGACAAAATCTTAGAAGTATAGGCTATATTAATATGCCAGTGCATTTCGAAAACCAGTTCCACATTATTCAGAGTCACGTAGTTCCAGAAGTTCAATCATCGCTTATTTTAGGGATTGACTTTTGGCACACATTTAAAATTTGCCCGAAGTACTTGAGTTCTCTTCATTTCCCCGGCCCTCCATTGGCTAATTTAGATGTTGGTAGCCCAACCAATTTTTTGCGCTCGTATGATTATTTGGACGAATCACAAAAGGCCGTCGTTGACAATATTACCAAGCAGTTTGAAGAAATATCTTTTGAGCGCAAAGGACTTGGACGCACAAACTTAATTACTCACCACATCGACACGGGGAATTCTCCTCCTGTGAGACAGCGCTACTATAGGCTTTCACCAGAGAAACAGAGAATCCTAGTCGAGCAAGTAGACGAAATGCTCCAGCTTGATGTAGTTGAGCCTTGTGAGAGTGCCTGGCAATCCCCGGTATTGCTAGTCACTAAAAAAGATGGTCAGCCGCGGTTCTGCTTAGATAGTAGGAAGCTAAACTCTGTTACAAAACGCGACGCTTATAACTTACCTTACATATCGGAGATATTGGACAACTTGCGAGACGCGCGCTATCTTAGCAGTATTGACTTATCAAAGGCTTTCTGGCAATTACCAATAGCACTCGAAGATAGGGACAAGACGGCATTTTACGTTCCGGGACGAGGGACGTTACGGTTCAAGACTACACCGTTTGGTTTGACCAATGCGCCTTCTACGCAACAGCGGTTAGTCGATTTATTGTTTGGCGACATGGATCACAAGGCGTTCGCATATTTAGATGATGTGATAATAGTAAGTAGCACGTTTGATGAGCATGTTAGTCTTCTTCTTCGCGTGTTAGACAAGCTGCGCCATGCTAATCTAACAATTAATTTAGAAAAGTGTGAATTTTTTCGAAGTAAACTTAAATATTTAGGCTATGTGGTCGACGCGAATGGTTTGCGGACTGATCCGGATAAAGTTACAGCCATTCTAAATTACCCAACTCCTACATGTCGTAAGGACTTGAAACGGTTCCTAGGCACGGCAACATGGTACCGGAGATTTGTCCCAAACTTTAGCACTATCGCAGGGCCGCTTAATAGGTTGTCGAACAAAAAATCAACACCTCCCTTCCAGTGGACAGATGAGGCCGACACTGCGTTCAAAAAACTTAAGGAATCTTTGGTCTCGGCACCTGTTCTCTCCTGCCCAAATTATGATCTGCCTTTCGAAGTCCATACAGATGCAAGTAACTATGGGATAGGTGGTATGCTCACACAAACTATTGACGGGAAAGAGCACCCTATAGCGTATATGAGCATGAATACCGTAGAGCGGTATAATAAAACAATTATTACTTGTATTTCTACGTTTGTTGATAGCGATCATCGGTCATGGGATACTTTTATTCCTAGTGTCCAGTTTGCCATTAATAATTCGGTTAACGAGGCTACTGGTTTCACTCCGTCATTTCTTGTCTTTGGCAGAGAACTAGTAATATGTGGCTCTCATTATACTGATATTGATTTGGGTGATCAAGTTTTGTTTCTACCTCGAGATCTGTATGCCGAAAACCTAGGGTGTTTGAGCTCCATCTTCGATCAAGTTCAGAAATCTTTATATCACGCACACGTAAAAAACACTGCTAACTATAATTTACGCAGAAAGCCTTTTGAATTTAATGTAGGAGATACTGTTTATAAACGCGCTTACGTCCTGAGTGACAAAGATAAGTATTTTAGTAAGAAGTTAGCACCGAAATATATCAAGTGCAAAGTTGTCGAAAAACTCTCGCCACTTGTCTACGTTCTAGAAGACATGTCGGGTAAAAACATAGGCACTTGGCATATTAAAGACTTGAAAATATTAGGTCAACACTCATAG
Protein
MVFTIKFLSLQKTELEYEVAIRGETPGATVADLRKQISKLSQSFPSEDILCSHLEPLDDLQAVLDLLNKVNASLESSPTDKSTLSRIENIFHHLYHRINRIVVDEVEKPHSACSKFFKESYEKFQKLSKKAVDPLLVCVSSSASASVPGIQAPINVAVTCDRGVTSELSRLKFDGKSCVRSFIQRVYEFSEARSIPDSKLLSSATEIFTDDALHWFRSIKDQVSSWDDLVVLLKKDFDKADYDYRLLAEIRARTQGETENITIYLAILSVSGLLDSGSAVTILGNNAHSALVSRGLELCTDDKLTIIAAGGQNLRSIGYINMPVHFENQFHIIQSHVVPEVQSSLILGIDFWHTFKICPKYLSSLHFPGPPLANLDVGSPTNFLRSYDYLDESQKAVVDNITKQFEEISFERKGLGRTNLITHHIDTGNSPPVRQRYYRLSPEKQRILVEQVDEMLQLDVVEPCESAWQSPVLLVTKKDGQPRFCLDSRKLNSVTKRDAYNLPYISEILDNLRDARYLSSIDLSKAFWQLPIALEDRDKTAFYVPGRGTLRFKTTPFGLTNAPSTQQRLVDLLFGDMDHKAFAYLDDVIIVSSTFDEHVSLLLRVLDKLRHANLTINLEKCEFFRSKLKYLGYVVDANGLRTDPDKVTAILNYPTPTCRKDLKRFLGTATWYRRFVPNFSTIAGPLNRLSNKKSTPPFQWTDEADTAFKKLKESLVSAPVLSCPNYDLPFEVHTDASNYGIGGMLTQTIDGKEHPIAYMSMNTVERYNKTIITCISTFVDSDHRSWDTFIPSVQFAINNSVNEATGFTPSFLVFGRELVICGSHYTDIDLGDQVLFLPRDLYAENLGCLSSIFDQVQKSLYHAHVKNTANYNLRRKPFEFNVGDTVYKRAYVLSDKDKYFSKKLAPKYIKCKVVEKLSPLVYVLEDMSGKNIGTWHIKDLKILGQHS

Summary

Pfam
PF17917   RT_RNaseH        + More
PF00078   RVT_1
PF00665   rve
PF17921   Integrase_H2C2
PF03732   Retrotrans_gag
Interpro
IPR003034   SAP_dom        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR005162   Retrotrans_gag_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
SUPFAM
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
4OL8     E-value=1.64178e-51,     Score=516

Ontologies

Topology

Length:
947
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0569800000000002
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00244
outside
1  -  947
 
 

Population Genetic Test Statistics

Pi
259.726176
Theta
183.367509
Tajima's D
1.477061
CLR
0.776151
CSRT
0.778511074446278
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号