SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03222
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.964
 

Sequence

CDS
ATGGAAAGTCAGAGTAATGAGTGTGATTTGTCATGCGCCCCGGCTAACCCCCGGCGCCCTCTGGTACCCGGGCCGGAGGGTGTGAAATCTGCTACCGAAGACGGCATAGAAGTGGCAACCCAGGCTTCTATGCCAGTAAATGCTACTGGTCAAAAGAAGTTAGTTCAGCAGGCATTCCATCCTAGCCTCTTTTTAAATCGGCCAAGAAGTTCGTCCCTAGGAAGTCTTTCGAACCAAGCGTCTGCTAAAGAAAAATGTAGTCAAAGCTCTGCGGACTCTGCCGAAACGCTAAGAGATACCACATGCCCACCACCATGGCAAAGAGTTCCTGTAAGCAGAGGTGTCAAAAGAAAGAAAACATCTTACGGTTCAGTCCCAGAATCTGTGATAACCTCAAATAAATTTAGTGGTCTTCAAATTGATCTAACAGACGAAGACTCTGAAACTACCACGGTTAAAAAAACAAGTAAACCGCCCCCAATTATTCTATATGGGGTCGACGACATTAACAAACTTACTGAAATGCTAGAAACTGTCGCGGACGTGACAGAGTTCACATTCAAGATCACTAATCGAAACCAACTAAGGATGAGCTGTGTTAACATGGATGTGTATAAAAGAATCCTTACCCTAGTGAGAGAAAAGGGGCTAATAGGCCACACTTTCAATCGAAAGGATGAAAGATGCCTCAGAATTGTCATACGGAACTTACACCCTTCTACACCCATTGACATTATCAAAGAAGAAGTAGAAGCCACCGGAAATATTGTTAAGGGAGAAATAATTAATGCGAAATTCGGCCCCGAAAAGAAGCCTACTTCCACCTTTTTCGTGAATCTCTTGCCCGGCCCAAACAATAAAGCTGCTAAAGACCTTAAATTTATATTCCATCAGTCTGTTGTTATCGAAGACCCGAAGAAAAGAAAGTCTATAATCCAATGTCACAGATGCCAGCAATACGGGCACTCTAAGAATTACTGTATGCGACCTCCTCGTTGTGTTAAATGCGGCCAATCTCATAAGACCTCCGATTGCGATAAAAAAGACCGTAATACACCTGCGCTTTGTGCACTCTGTAGTGGACCACATCCAGCCAACTATAAAGGATGCGAGATATCTGCTCCGGACGATACCTCATACCTTGAATACCCCGGCTACGTATTGGAGCACAACTTCCTGCGTAAAGCCGGGGTGTGCGTATTCGTCCGGGCTGATGTCTGTTGTCGCCGTCTTCGGGGCCTCGAAAAACGGGACCTGTCCCTCTTGTGGCTGCGCGTAGATCACGGGGGCTGTACCCGAATCTACGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGGTTCAGCTCTGTTTGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTGGTGGTTCTTGGAGACTTTAACGCTCACCACCAAGAGTGGTTGGGGTCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTGGCCTACGGCTTCTCCCAGCTGGTGACACAGCCCACCCGTGTCCCAGATATCGAGGGGCACGAACCTTCTTTGTTGGACCTTCTGCTGACCACGGATCCAGCCGGATACAGTGTGGTGGTCGACGCTCCGCTTGGATCGTCTGATCACTGCCTTATCCGTGCTGCCGTACCACTCTCTCGTCCTGGTCGTCGAACGACGACCGGGTATCGAAGAGTTTGGAAGTATATGTCAGCAGATTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGGCCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCGTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTGGCATGGGATAGTGCCAGGAGACGTCAGGACCCTAACATCTCAGAGGAAAGGCGGAAATATAACGCCGCTTCTAGGTCCTACAAGAAGGTTATTGCCAAGGCGAAGTCGGAGCACGTCGCTAGAGTTGGCGAGCGATTGAAGAGCTATCCCTCCGGGAGCCGTGCTTTTTGGTCGCTCGCCAAGGCTGCAGAAGGAAACTTTTGCAGGTCTAGTCTCCCACCACTGCGCAAGTCCGATGACAATCTGGCCCACAGCGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATCCCTCGGTGTGATAGCTCCCTGCCAGATATCTGCTTCACACAGTGTGCAGTCAGGCGGGAGCTCCGACTCCTGGACGTCCATAAGTCGAGTGGGCCAGACGGCATCCCCGCAGTGGTTTTGAAAACGTGCGCCCCTGAGCTGACACCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCACTAACAGGGTTCCGTCTTCATGGAAGACCGCCCACGTCCACCCTATCCCCAGGAAGGGTGACCGGTCGGACCCATCGAGCTACAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATAATTAATACACAACTCCTGAAGTATCTTGAAGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCGTCACGGTCGTTGTAGACGGTGACTGCTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATACATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCATGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCGAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGATAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCATGGAGTGCTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATCCTCTCGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCAGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGATCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAGCGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGGAAACCCTTGATGAAAAAATTGACCTGAAAGTAGCTCTGAAAACACCTGATGATATTGAAAATGCGACTAGATACATAACTAATCTGATCCAAGAAGCATGCTGGGTGTCCACGCCTGAAGAAGAGTCTGTAAAAACTCGTATAAACTATCCACTGGAAGTCAAAAAGGCAGTACTGGAAAAGAGGAGGCTTAGAAGAGTCTGGCACCAAAGCAGATTAGAAGCAGACAAGAAAGCGCTGTATAGGAGTGCGGTTCAACTAAAAGAAATACTGAACAACTGGCACAATAAAACGTTGGAGGATCGTCTCGTGACACTAACAGCCACTGCAGCAACTAATTACTCGTTGTGGAAATTCACCAAGAATTATAGCAGACCTCAGTCATTCAAACCTCCGATAAAAACCATGAATGGTTGGGCGCGAACATCTCAAGAAAAAGCAAACGCATTCGCTCAACATCTTGAATCAGTTTTTAAACCAAATGCTGACATAGATTTAGTACATGAGGAACATATCAATGAAATTCTGCTACAAGACTTCCAAATGCTACCCCCACAGCGGCCAGTCACAGTACGCGAAGTTTGGAGAGTTATATCAAAACTACAGGATAAAAAGGCTCCCGGATATGATCTTATAACCAAGGAGATATTAAAACAAATTCCAAGGAAGGTGGTAGTGTTCCTGACTTCACTCTATAATAGCATACTAAGAGTCCAGTATTTTCCAATGGCCTGGAAAGTATCTCACATAATTATGATTCACAAGATGGGCAAACCACCCAATGAAGTATCCTCATACCGACCTATAAGCTTGCTGCCAATACTTTCCAAAGTTTTCGAGAAGCTCCTGAAAGGTAGACTTGTCCCAATCCTCAATGACGAAAAAATCATTCCTGATCATCAATTTGGGTTTAGACGAAATCATGGCACGGTCGAACAAGTTCACAGAGTCTGTGAAAAAATACGCAAAAGTTTGGAAGAAAAACTCTACTGCTCCTCGGCGTTTCTAGATATACAGCAGGCCTTTGATAAAGTGTGGCATAAAGGCCTCCTGTATAAATTAAAGGCAGCGCTACCTCATCAGTATTATTGTCTGCTAAAATCGTATCTCGCAGACAGAATATTCCAGGTGAAAGAAGGGGATTCTCTGTCACGATTCTGCGATATCTCAGCAGGTGTACCACAGGGATCAGTCCTGGGACCACTATTATATACTATATACACTGCTGACCTACCTGAGGTTAATGATGTTACCACTGCAACATTCGCCGATGATACTGCAATATTGGCGAGTCACACGGATCGTTTTGTAGCATCACAGAGATTGCAAAAAGGTCTTGATAAAATATCCACATGGCTACAGAAGTGGCGAATAAAAGCCAGTGCAAACAAGTCGGTACATGTTACATTCACATTGCGAAAAGGTGATTGTCCACCTGTCCATGTTAATAACGCTATATTGCCCCATCAAGACAATGTAAGATACCTGGGAATGCACTTGGACCGCCGCCTAACATGGAAACACCACATTCAAACTAAGAGACAGGAACTAAACATCCGATACAAAAATCTCCATTGGCTGTTGGGACGTAACAGCAAGCTGAGTGTTGACAACAAACTTTTAATTTACAAAGTTATCTTTAAGCCAGTTTGGCTGTACGGAATCGAATTATGGGGTAGCGCCTGCAATTCGAATATCAGTATTATACAAAGAATGCAAAACTGTATCTTGCGCTCCATAAGTGGTGTTCCGTGGTTGGTCACAAACACTGAAATACACAAAGAACTAGGGATGCCTACAATAATGCAGGAAATCGTAAAATTTAAACAAAAACACCACGAAAGACTGGAAAAGCACCCAAACAATCTGGCTGCCGCCTTGAAAAAACGAAGTTACGATAAACGGCTCAAGAGAAAAGACGTCATATAG
Protein
MESQSNECDLSCAPANPRRPLVPGPEGVKSATEDGIEVATQASMPVNATGQKKLVQQAFHPSLFLNRPRSSSLGSLSNQASAKEKCSQSSADSAETLRDTTCPPPWQRVPVSRGVKRKKTSYGSVPESVITSNKFSGLQIDLTDEDSETTTVKKTSKPPPIILYGVDDINKLTEMLETVADVTEFTFKITNRNQLRMSCVNMDVYKRILTLVREKGLIGHTFNRKDERCLRIVIRNLHPSTPIDIIKEEVEATGNIVKGEIINAKFGPEKKPTSTFFVNLLPGPNNKAAKDLKFIFHQSVVIEDPKKRKSIIQCHRCQQYGHSKNYCMRPPRCVKCGQSHKTSDCDKKDRNTPALCALCSGPHPANYKGCEISAPDDTSYLEYPGYVLEHNFLRKAGVCVFVRADVCCRRLRGLEKRDLSLLWLRVDHGGCTRIYACLYRSHSSDAGSALFEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRTAYDFALAYGFSQLVTQPTRVPDIEGHEPSLLDLLLTTDPAGYSVVVDAPLGSSDHCLIRAAVPLSRPGRRTTTGYRRVWKYMSADWDGLREFYASYPWGRFCFSSADPDVCAGRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDSARRRQDPNISEERRKYNAASRSYKKVIAKAKSEHVARVGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDNLAHSAKEKADLLVKLFASNSTVDDGGATPPNIPRCDSSLPDICFTQCAVRRELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCTNRVPSSWKTAHVHPIPRKGDRSDPSSYRPIAITSLLSKVMERIINTQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSVTVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGIHCYADDSTGDARYIGHQSLSRSMVQERRSKLVSEVENSLGRVSEWGELNLVQFNPIKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRMECCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILSDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRRETLDEKIDLKVALKTPDDIENATRYITNLIQEACWVSTPEEESVKTRINYPLEVKKAVLEKRRLRRVWHQSRLEADKKALYRSAVQLKEILNNWHNKTLEDRLVTLTATAATNYSLWKFTKNYSRPQSFKPPIKTMNGWARTSQEKANAFAQHLESVFKPNADIDLVHEEHINEILLQDFQMLPPQRPVTVREVWRVISKLQDKKAPGYDLITKEILKQIPRKVVVFLTSLYNSILRVQYFPMAWKVSHIIMIHKMGKPPNEVSSYRPISLLPILSKVFEKLLKGRLVPILNDEKIIPDHQFGFRRNHGTVEQVHRVCEKIRKSLEEKLYCSSAFLDIQQAFDKVWHKGLLYKLKAALPHQYYCLLKSYLADRIFQVKEGDSLSRFCDISAGVPQGSVLGPLLYTIYTADLPEVNDVTTATFADDTAILASHTDRFVASQRLQKGLDKISTWLQKWRIKASANKSVHVTFTLRKGDCPPVHVNNAILPHQDNVRYLGMHLDRRLTWKHHIQTKRQELNIRYKNLHWLLGRNSKLSVDNKLLIYKVIFKPVWLYGIELWGSACNSNISIIQRMQNCILRSISGVPWLVTNTEIHKELGMPTIMQEIVKFKQKHHERLEKHPNNLAAALKKRSYDKRLKRKDVI

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=4.91664e-05,     Score=118

Ontologies

GO

Topology

Length:
1946
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.519009999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1946
 
 

Population Genetic Test Statistics

Pi
287.622637
Theta
172.667343
Tajima's D
1.9954
CLR
43.436861
CSRT
0.88165591720414
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号