SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03194
Annotation
PREDICTED:_uncharacterized_protein_LOC101735858_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.811 PlasmaMembrane   Reliability : 1.889
 

Sequence

CDS
ATGGGAGACTTCAAAACCGACCTCCTTGTCCCTTTGTCCACTCGTTTACGAAAACTCCTTGACCTTGTTGAGTCAGTTAGTTTACACATCCTCCCTTTACTAGCCACTCACCACAACATTGAAGGAGAGGATACCTGGCTTGACCTAATACTCACTTCCAATCCCGATCTTGTTCATTCTCACGGTCAGTTTCCTGCTCCTGGTTTCTCCTACCATGACCTCATTTACTTATCCTACGTCCTTAAACCTCCCAAATCCAAGCCTAAAGTTTTACGCGTGCGTTGTTTTGGTCGCATGGATGGACGCAGGTTGTGTGAGGATGCTGCTAAAATTAGTTGGGATGAACTGACGGCAGCTACATCTATTGACGACAAGGTGACTATATTTAACGCTCAACTCCAGGCACTTTATGACACTCATGCTCCCGTCAGGAAATTCAAGTTGAAACGTCCTCCAGCACCTTGGATGACGAGTGAGGTTCGGATGGCGATGAAGCGTAGGGATCGGGCCTTGGCAAAATTCAGGAGACGCCGCACGGAGGAAAACTGGACATCATTTAAGGTTGCGACGAATCGGTGTAATCAGATGGTACGGAACGCTAAGCGCCGCCATATTCTCGAAAATATAACCTCCGCTTCTTCAGCGAATATCTGGAAGTTCTTTAAGACTCTGGGTACTGGTAGGGAGAAGAATAAAGACTTCCAGGGGACCATTGCCTTAGATGACCTTAACAGGCATTTCAGCGCATCTGCCGGCATTGATCATCAAGTCAAAAGTCTCACTATTGAATTTATAGCTGGGTTACCTAAACCAGACATTGACCCCTTCCAATTTTCTCCAATGACTTCAGATGATATTAAAAAGATTATCCTATCCATTAGATCTAATGCTGTTGGTTATGACAAAATCACCCATCGCATGATTACCACAGCTTTAGACCATCTTATTCTCACCATAACCCACATCATTAATTTCTCCTTTAGTACCAACATGTTTCCCTCCCAATGGCGTAAGGCTTATGTCATTCCTCTTCCTAAAATACCGAATCCTACCCTTGTTACTCATTTCCGACCTATATCCATACTTCCTTTCCTATCTAAGGTTTTAGAAGCTTGTGCGCACAAACAACTGTCCAATTTTATTCATTCACAACATTTGTTGAGTACATTGCAGTCCGGTTTCAGACCTTGCCACAGCACTACTACCGCACTCCTTAAAGTGATTGGCGATATTAGAGCAGGTATGGAGGACACAAAGGTTACGGTATTGGTTCTGATAGACTTCTCAAACGCTTTTAATAACGTCAATCACGACATCCTCTTATCCATTCTCTCCCATCTTAGGATGTCATCTGGAGCATTGGATTGGTTCTCGTCTTATCTTCGAGGTCGTCAGCAGTCGATACACATCAACGAGTTTTCGTCTAGTTGGTGTGATCTGCACTCTGGCGTTCCTCAAGGCGGCATTCTTTCTCCTCTACTATTTTCAATTTTTATTAATCTCATTACCGATAATCTTCAATGTGCGTACCATCTATATGCCGATGATTTGCAGCTTTATGCTCAGGCTGGAGTCGATAATGTGTCTTCGGCAGTTGGTAAAATAAATAACGACCTGTCCTACATTAAATTCTGGTCTGACAGTTTCGGCTTAAGCGTGAATCCCGCCAAATGTCAGGCTATTATTGTTGGAAGTCAACGCTTGTTGTATCGGTTGGATATGGCATATGTCCCATCGGTTATATATGATGGCTCAACCATCAACTGGTGTTCAGTTGTAAAGGACCTAGGCCTACTTATTGACTCCAGCCTGAGCTGGCGAGGTCAGGCCCAGGTCATCTCCGTGTGTCAGCGAGTTACACTTACACTCCGTATGCTTTACCGCTGA
Protein
MGDFKTDLLVPLSTRLRKLLDLVESVSLHILPLLATHHNIEGEDTWLDLILTSNPDLVHSHGQFPAPGFSYHDLIYLSYVLKPPKSKPKVLRVRCFGRMDGRRLCEDAAKISWDELTAATSIDDKVTIFNAQLQALYDTHAPVRKFKLKRPPAPWMTSEVRMAMKRRDRALAKFRRRRTEENWTSFKVATNRCNQMVRNAKRRHILENITSASSANIWKFFKTLGTGREKNKDFQGTIALDDLNRHFSASAGIDHQVKSLTIEFIAGLPKPDIDPFQFSPMTSDDIKKIILSIRSNAVGYDKITHRMITTALDHLILTITHIINFSFSTNMFPSQWRKAYVIPLPKIPNPTLVTHFRPISILPFLSKVLEACAHKQLSNFIHSQHLLSTLQSGFRPCHSTTTALLKVIGDIRAGMEDTKVTVLVLIDFSNAFNNVNHDILLSILSHLRMSSGALDWFSSYLRGRQQSIHINEFSSSWCDLHSGVPQGGILSPLLFSIFINLITDNLQCAYHLYADDLQLYAQAGVDNVSSAVGKINNDLSYIKFWSDSFGLSVNPAKCQAIIVGSQRLLYRLDMAYVPSVIYDGSTINWCSVVKDLGLLIDSSLSWRGQAQVISVCQRVTLTLRMLYR

Summary

EMBL
NWSH01000817    PCG74070.1    GEBQ01020572    JAT19405.1    NWSH01000893    PCG73654.1    + More
LBMM01014048    KMQ85356.1    LBMM01017805    KMQ83966.1    GBHO01031326    GBHO01031325    JAG12278.1    JAG12279.1    GEBQ01013060    GEBQ01010336    JAT26917.1    JAT29641.1    GBHO01012041    GBHO01012038    JAG31563.1    JAG31566.1    LBMM01010997    KMQ87090.1    DMQF01000352    HAO15199.1    GEBQ01027915    JAT12062.1    GBBI01004799    JAC13913.1    DMQF01000361    HAO15230.1    DNUT01000507    HBI41157.1    GEHC01000896    JAV46749.1    GANO01004126    JAB55745.1    LBMM01004152    KMQ92759.1    DMQF01000157    HAO14486.1    DNUT01000056    HBI39512.1    DMQF01000003    HAO13943.1    DNUT01000451    HBI40968.1    GANO01003893    JAB55978.1    GANO01004094    JAB55777.1    GAMC01021038    GAMC01021033    GAMC01021031    JAB85522.1    GAMC01021037    GAMC01021036    JAB85519.1    QOIP01000004    RLU23301.1    GANO01004066    JAB55805.1    GANO01004361    JAB55510.1    DMQF01000478    HAO15711.1    GANO01004338    JAB55533.1    GEBQ01030598    JAT09379.1    GANO01004362    JAB55509.1    GANO01004198    JAB55673.1    DNUT01000170    HBI39961.1    GEZM01074146    JAV64657.1    GANO01004238    JAB55633.1    LSMT01000554    PFX16333.1    GEHC01001007    JAV46638.1    GEHC01000892    JAV46753.1    GANO01004275    JAB55596.1    DMQF01000030    HAO14052.1    GEHC01000940    JAV46705.1    GANO01003995    JAB55876.1    GEHC01000909    JAV46736.1    GEZM01041318    GEZM01041317    JAV80524.1    GALA01001237    JAA93615.1    DNUT01000297    HBI40414.1    GEZM01074147    JAV64656.1    GEZM01007604    JAV95063.1    AAZX01004038    GECU01021424    JAS86282.1    GANO01004070    JAB55801.1    GANO01004325    JAB55546.1    GANO01004166    JAB55705.1    GANO01001936    JAB57935.1    AAZX01023386    GEZM01008907    JAV94684.1    GEZM01000581    JAV98361.1    NWSH01001817    PCG70032.1    GEZM01051381    GEZM01051380    JAV74995.1    GFDF01007660    JAV06424.1    KZ150070    PZC74075.1    GEZM01045590    GEZM01045589    JAV77734.1    NWSH01000010    PCG80923.1    GANO01004069    JAB55802.1    GBHO01015041    JAG28563.1    AAZX01004360    AAZX01016008    AAZX01017248    DQ099730    AAZ15237.1    GANO01004258    JAB55613.1    LBMM01003452    KMQ93522.1    LSMT01000038    PFX31271.1    NWSH01000998    PCG73165.1    LSMT01000382    PFX18982.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR011011   Znf_FYVE_PHD       
SUPFAM
SSF56219   SSF56219        + More
SSF57903   SSF57903       
Gene 3D
PDB
6AR3     E-value=1.42254e-06,     Score=127

Ontologies

Topology

Length:
628
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.38629
Exp number, first 60 AAs:
0.00117
Total prob of N-in:
0.00149
outside
1  -  628
 
 

Population Genetic Test Statistics

Pi
16.908168
Theta
14.406706
Tajima's D
0.520761
CLR
0
CSRT
0.526423678816059
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号