Gene

KWMTBOMO03182

Pre Gene Modal

BGIBMGA013453

Annotation

cyclin-dependent_kinase_2_[Bombyx_mori]

Location

Bomo_Chr6(+):927223-933194      View in EpiBrowser

Full name

Cyclin-dependent kinase 2      

Alternative Name

Cell division protein kinase 2
p33 protein kinase

Location in the cell

Cytoplasmic   Reliability : 2.383

CDS

ATGGAGAATTTTTCTACTGTAGAAAAAATAGGGGAAGGAACATATGGTGTAGTTTACAAAGCCAAAGACAGGGTCACCGGACAAGAAATCGCGTTGAAGAAAATCAAACTTGAAAATGAACCTGAGGGTGTACCATCAACAGCCTTACGGGAGATCTCAGTGCTGCGAGAACTTCGACATCCAGCAGTTGTACGGCTCCTTGATGTTATGCTGGCATCTTCAGACAGTAAACTGTTTCTTGTCTTTGAATATTTGAATATGGATCTCAAAAGACTCATGGATCTGACGAAGGGACCACTACCTATTGATTTAGTTAAGAGTTATTTACGACAGTTACTGGAAGGTGTTGCGTACTGTCACGCCCAACGTGTTCTCCACAGAGACCTGAAGCCCCAGAACCTACTAATAGACGAGGAAGGTCACATTAAATTGGCCGATTTCGGTTTGGCTCGAGCTTTTGGTATCCCTGTGCGTGCTTACACACATGAGGTGGTCACACTATGGTACCGTGCACCAGAAATCCTTCTTGGGGCTAAGTTCTACTCAACCGCCGTTGATGTTTGGAGCTTAGCCTGTATTTTTGCAGAGATGGCAAGCGGTCGCACTCTTTTCCCCGGTGACAGTGAAATAGACCAGCTATTCCGCGTATTCCGAGCGCTGGGTACACCAGGCGAGGCACTATGGCCGGCAGCGAGAAGACTTCCTGACTTCCGAGCCGCCTTCCCGCGATGGCCTGCCCGACCTGCCCGAACATTACTACCAGCAGGACTCCGAGCGCACAGTTCAGCGGCAGCGTTGTTTGAGGCCATGCTGCGTTATGAACCTGAGACTCGAATTCCTGCCCGAGCTGCTCTTACGCATCCTTACTTGGCTGATGCGACTCTGGTGCCGCCTCCTCTACATCCTTAA

Protein

MENFSTVEKIGEGTYGVVYKAKDRVTGQEIALKKIKLENEPEGVPSTALREISVLRELRHPAVVRLLDVMLASSDSKLFLVFEYLNMDLKRLMDLTKGPLPIDLVKSYLRQLLEGVAYCHAQRVLHRDLKPQNLLIDEEGHIKLADFGLARAFGIPVRAYTHEVVTLWYRAPEILLGAKFYSTAVDVWSLACIFAEMASGRTLFPGDSEIDQLFRVFRALGTPGEALWPAARRLPDFRAAFPRWPARPARTLLPAGLRAHSSAAALFEAMLRYEPETRIPARAALTHPYLADATLVPPPLHP

Description

Serine/threonine-protein kinase involved in the control of the cell cycle; essential for meiosis, but dispensable for mitosis. Phosphorylates CTNNB1, USP37, p53/TP53, NPM1, CDK7, RB1, BRCA2, MYC, NPAT, EZH2. Triggers duplication of centrosomes and DNA. Acts at the G1-S transition to promote the E2F transcriptional program and the initiation of DNA synthesis, and modulates G2 progression; controls the timing of entry into mitosis/meiosis by controlling the subsequent activation of cyclin B/CDK1 by phosphorylation, and coordinates the activation of cyclin B/CDK1 at the centrosome and in the nucleus. Crucial role in orchestrating a fine balance between cellular proliferation, cell death, and DNA repair in human embryonic stem cells (hESCs). Activity of CDK2 is maximal during S phase and G2; activated by interaction with cyclin E during the early stages of DNA synthesis to permit G1-S transition, and subsequently activated by cyclin A2 (cyclin A1 in germ cells) during the late stages of DNA replication to drive the transition from S phase to mitosis, the G2 phase. EZH2 phosphorylation promotes H3K27me3 maintenance and epigenetic gene silencing. Phosphorylates CABLES1 (By similarity). Cyclin E/CDK2 prevents oxidative stress-mediated Ras-induced senescence by phosphorylating MYC. Involved in G1-S phase DNA damage checkpoint that prevents cells with damaged DNA from initiating mitosis; regulates homologous recombination-dependent repair by phosphorylating BRCA2, this phosphorylation is low in S phase when recombination is active, but increases as cells progress towards mitosis. In response to DNA damage, double-strand break repair by homologous recombination a reduction of CDK2-mediated BRCA2 phosphorylation. Phosphorylation of RB1 disturbs its interaction with E2F1. NPM1 phosphorylation by cyclin E/CDK2 promotes its dissociates from unduplicated centrosomes, thus initiating centrosome duplication. Cyclin E/CDK2-mediated phosphorylation of NPAT at G1-S transition and until prophase stimulates the NPAT-mediated activation of histone gene transcription during S phase. Required for vitamin D-mediated growth inhibition by being itself inactivated. Involved in the nitric oxide- (NO) mediated signaling in a nitrosylation/activation-dependent manner. USP37 is activated by phosphorylation and thus triggers G1-S transition. CTNNB1 phosphorylation regulates insulin internalization. Phosphorylates FOXP3 and negatively regulates its transcriptional activity and protein stability (PubMed:23853094). Phosphorylates CDK2AP2 (By similarity).
Serine/threonine-protein kinase involved in the control of the cell cycle; essential for meiosis, but dispensable for mitosis. Phosphorylates CTNNB1, USP37, p53/TP53, NPM1, CDK7, RB1, BRCA2, MYC, NPAT, EZH2. Triggers duplication of centrosomes and DNA. Acts at the G1-S transition to promote the E2F transcriptional program and the initiation of DNA synthesis, and modulates G2 progression; controls the timing of entry into mitosis/meiosis by controlling the subsequent activation of cyclin B/CDK1 by phosphorylation, and coordinates the activation of cyclin B/CDK1 at the centrosome and in the nucleus. Crucial role in orchestrating a fine balance between cellular proliferation, cell death, and DNA repair in human embryonic stem cells (hESCs). Activity of CDK2 is maximal during S phase and G2; activated by interaction with cyclin E during the early stages of DNA synthesis to permit G1-S transition, and subsequently activated by cyclin A2 (cyclin A1 in germ cells) during the late stages of DNA replication to drive the transition from S phase to mitosis, the G2 phase. EZH2 phosphorylation promotes H3K27me3 maintenance and epigenetic gene silencing. Phosphorylates CABLES1 (By similarity). Cyclin E/CDK2 prevents oxidative stress-mediated Ras-induced senescence by phosphorylating MYC. Involved in G1-S phase DNA damage checkpoint that prevents cells with damaged DNA from initiating mitosis; regulates homologous recombination-dependent repair by phosphorylating BRCA2, this phosphorylation is low in S phase when recombination is active, but increases as cells progress towards mitosis. In response to DNA damage, double-strand break repair by homologous recombination a reduction of CDK2-mediated BRCA2 phosphorylation. Phosphorylation of RB1 disturbs its interaction with E2F1. NPM1 phosphorylation by cyclin E/CDK2 promotes its dissociates from unduplicated centrosomes, thus initiating centrosome duplication. Cyclin E/CDK2-mediated phosphorylation of NPAT at G1-S transition and until prophase stimulates the NPAT-mediated activation of histone gene transcription during S phase. Required for vitamin D-mediated growth inhibition by being itself inactivated. Involved in the nitric oxide- (NO) mediated signaling in a nitrosylation/activation-dependent manner. USP37 is activated by phosphorylation and thus triggers G1-S transition. CTNNB1 phosphorylation regulates insulin internalization. Phosphorylates FOXP3 and negatively regulates its transcriptional activity and protein stability (By similarity). Phosphorylates CDK2AP2 (By similarity).
Serine/threonine-protein kinase involved in the control of the cell cycle; essential for meiosis, but dispensable for mitosis. Phosphorylates CTNNB1, USP37, p53/TP53, NPM1, CDK7, RB1, BRCA2, MYC, NPAT, EZH2. Triggers duplication of centrosomes and DNA. Acts at the G1-S transition to promote the E2F transcriptional program and the initiation of DNA synthesis, and modulates G2 progression; controls the timing of entry into mitosis/meiosis by controlling the subsequent activation of cyclin B/CDK1 by phosphorylation, and coordinates the activation of cyclin B/CDK1 at the centrosome and in the nucleus. Crucial role in orchestrating a fine balance between cellular proliferation, cell death, and DNA repair in human embryonic stem cells (hESCs). Activity of CDK2 is maximal during S phase and G2; activated by interaction with cyclin E during the early stages of DNA synthesis to permit G1-S transition, and subsequently activated by cyclin A2 (cyclin A1 in germ cells) during the late stages of DNA replication to drive the transition from S phase to mitosis, the G2 phase. EZH2 phosphorylation promotes H3K27me3 maintenance and epigenetic gene silencing. Phosphorylates CABLES1 (By similarity). Cyclin E/CDK2 prevents oxidative stress-mediated Ras-induced senescence by phosphorylating MYC. Involved in G1-S phase DNA damage checkpoint that prevents cells with damaged DNA from initiating mitosis; regulates homologous recombination-dependent repair by phosphorylating BRCA2, this phosphorylation is low in S phase when recombination is active, but increases as cells progress towards mitosis. In response to DNA damage, double-strand break repair by homologous recombination a reduction of CDK2-mediated BRCA2 phosphorylation. Phosphorylation of RB1 disturbs its interaction with E2F1. NPM1 phosphorylation by cyclin E/CDK2 promotes its dissociates from unduplicated centrosomes, thus initiating centrosome duplication. Cyclin E/CDK2-mediated phosphorylation of NPAT at G1-S transition and until prophase stimulates the NPAT-mediated activation of histone gene transcription during S phase. Required for vitamin D-mediated growth inhibition by being itself inactivated. Involved in the nitric oxide- (NO) mediated signaling in a nitrosylation/activation-dependent manner. USP37 is activated by phosphorylation and thus triggers G1-S transition. CTNNB1 phosphorylation regulates insulin internalization. Phosphorylates FOXP3 and negatively regulates its transcriptional activity and protein stability (By similarity). Phosphorylates CDK2AP2 (PubMed:12944431).

Catalytic Activity

ATP + L-seryl-[protein] = ADP + H(+) + O-phospho-L-seryl-[protein]
ATP + L-threonyl-[protein] = ADP + H(+) + O-phospho-L-threonyl-[protein]

Cofactor

Mg(2+)

Subunit

Found in a complex with CABLES1, CCNA1 and CCNE1. Interacts with CABLES1 (PubMed:11585773). Interacts with UHRF2. Part of a complex consisting of UHRF2, CDK2 and CCNE1. Interacts with the Speedy/Ringo proteins SPDYA and SPDYC. Interaction with SPDYA promotes kinase activation via a conformation change that alleviates obstruction of the substrate-binding cleft by the T-loop. Found in a complex with both SPDYA and CDKN1B/KIP1. Binds to RB1 and CDK7. Binding to CDKN1A (p21) leads to CDK2/cyclin E inactivation at the G1-S phase DNA damage checkpoint, thereby arresting cells at the G1-S transition during DNA repair. Associated with PTPN6 and beta-catenin/CTNNB1. Interacts with CACUL1. May interact with CEP63. Interacts with ANKRD17 (By similarity). Interacts with CEBPA (when phosphorylated) (PubMed:15107404). Forms a ternary complex with CCNA2 and CDKN1B; CDKN1B inhibits the kinase activity of CDK2 through conformational rearrangements. Interacts with cyclins A, B1, B3, D, or E. Interacts with CDK2AP2 (By similarity).
Found in a complex with CABLES1, CCNA1 and CCNE1. Interacts with CABLES1 (By similarity). Interacts with UHRF2. Part of a complex consisting of UHRF2, CDK2 and CCNE1. Interacts with the Speedy/Ringo proteins SPDYA and SPDYC. Interaction with SPDYA promotes kinase activation via a conformation change that alleviates obstruction of the substrate-binding cleft by the T-loop. Found in a complex with both SPDYA and CDKN1B/KIP1. Binds to RB1 (PubMed:10542199). Binds to CDK7. Binding to CDKN1A (p21) leads to CDK2/cyclin E inactivation at the G1-S phase DNA damage checkpoint, thereby arresting cells at the G1-S transition during DNA repair. Associated with PTPN6 and beta-catenin/CTNNB1. Interacts with CACUL1. May interact with CEP63. Interacts with ANKRD17. Interacts with CEBPA (when phosphorylated). Forms a ternary complex with CCNA2 and CDKN1B; CDKN1B inhibits the kinase activity of CDK2 through conformational rearrangements. Interacts with cyclins A, B1, B3, D, or E. Interacts with CDK2AP2 (By similarity).
Found in a complex with CABLES1, CCNA1 and CCNE1. Interacts with CABLES1 (By similarity). Interacts with UHRF2. Part of a complex consisting of UHRF2, CDK2 and CCNE1. Interacts with the Speedy/Ringo proteins SPDYA and SPDYC. Interaction with SPDYA promotes kinase activation via a conformation change that alleviates obstruction of the substrate-binding cleft by the T-loop. Found in a complex with both SPDYA and CDKN1B/KIP1. Binds to RB1 and CDK7. Binding to CDKN1A (p21) leads to CDK2/cyclin E inactivation at the G1-S phase DNA damage checkpoint, thereby arresting cells at the G1-S transition during DNA repair. Associated with PTPN6 and beta-catenin/CTNNB1. Interacts with CACUL1. May interact with CEP63. Interacts with ANKRD17. Interacts with CEBPA (when phosphorylated). Forms a ternary complex with CCNA2 and CDKN1B; CDKN1B inhibits the kinase activity of CDK2 through conformational rearrangements. Interacts with cyclins A, B1, B3, D, or E. Interacts with CDK2AP2 (By similarity).
Found in a complex with CABLES1, CCNA1 and CCNE1. Interacts with CABLES1 (By similarity). Interacts with UHRF2. Part of a complex consisting of UHRF2, CDK2 and CCNE1. Interacts with the Speedy/Ringo proteins SPDYA and SPDYC (PubMed:15611625). Interaction with SPDYA promotes kinase activation via a conformation change that alleviates obstruction of the substrate-binding cleft by the T-loop (PubMed:28666995). Found in a complex with both SPDYA and CDKN1B/KIP1 (PubMed:12972555, PubMed:28666995). Binds to RB1 and CDK7. Binding to CDKN1A (p21) leads to CDK2/cyclin E inactivation at the G1-S phase DNA damage checkpoint, thereby arresting cells at the G1-S transition during DNA repair. Associated with PTPN6 and beta-catenin/CTNNB1. Interacts with CACUL1. May interact with CEP63. Interacts with ANKRD17. Interacts with CEBPA (when phosphorylated) (PubMed:15107404). Forms a ternary complex with CCNA2 and CDKN1B; CDKN1B inhibits the kinase activity of CDK2 through conformational rearrangements (PubMed:8684460). Interacts with cyclins A, B1, B3, D, or E (PubMed:10499802, PubMed:10884347, PubMed:12185076, PubMed:23781148). Interacts with CDK2AP2 (PubMed:23781148).

Similarity

Belongs to the protein kinase superfamily.
Belongs to the protein kinase superfamily. CMGC Ser/Thr protein kinase family. CDC2/CDKX subfamily.

Keywords

Acetylation   Alternative splicing   ATP-binding   Cell cycle   Cell division   Complete proteome   Cytoplasm   Cytoskeleton   DNA damage   DNA repair   Endosome   Kinase   Magnesium   Meiosis   Metal-binding   Mitosis   Nucleotide-binding   Nucleus   Phosphoprotein   Reference proteome   Transferase   3D-structure   Polymorphism   S-nitrosylation  

Feature

chain  Cyclin-dependent kinase 2
splice variant  In isoform CDK2-alpha.
sequence variant  In dbSNP:rs3087335.

Uniprot

H6VMF4   A0A2H1V8G8   S4PMI6   A0A437BI96   A0A2W1BA74   A0A2A4JVV4   + More
A0A212ELY3   A0A0L7LM44   A0A0N0U5C0   H3BI57   O46161   A0A2A3E5Z8   A0A087ZNC2   A0A310SE63   G1P317   S7NB09   V4B3L0   A0A0L7R4I8   A0A154PB06   G3TH75   W4XW48   T0MEU0   A0A287AXP1   A0A2Y9GUJ7   F6US96   E2QW70   A0A341AR07   A0A3Q7RF90   A0A340Y2B2   A0A2I2V4K7   A0A2U3XBV5   A0A2Y9L521   A0A3Q7SQ67   A0A2Y9NEE7   A0A2U3W1B4   A0A383ZXG1   A0A452RHR8   A0A3Q7X0F6   A0A384DTG0   D2H336   H0WVH2   A0A2Y9FRU8   A0A2K6GY84   A0A1S3FMH0   P97377-2   Q6P751   Q3U6X7   A0A2Y9DS22   L8Y724   Q63699   G3W161   E2ALN7   I3LWC0   T1J0E3   A0A2K5DF40   A0A2K5QXK8   F7BWH8   A0A1U8C8E6   O55076   A0A286XH18   G5BB95   L8HYF4   B7U171   A0MSV8   Q5E9Y0   A0A401PCX1   A0A1U7U8H5   A0A2K6E4W9   A0A2K6MMD4   G3QIR0   A0A2K5XCR8   A0A0D9QZ04   A0A2R9B4E4   A0A096MYH8   A0A2K6P9I2   A0A2K5NT27   A0A2K5IHJ1   H2NHM8   G7PIG0   G7N7A7   H2Q670   A0A024RB77   P24941   A0A158NMZ5   A0A2Y9GC92   A2IAR9   A0A151JVM2   A0A3M6URQ2   P48963   M3W4N5   A0A452GT32   A0A2Y9GF67   A0A226MDZ0   A0A226MMP6   A0A195DBS4   F1RW06   A0A151I170   A0A401SB05   H9GA76   A0A1S3ALH3  

EC Number

2.7.11.22

Pubmed

19121390    23622113    28756777    22118469    26227816    9215903    + More
9705226    21993624    23254933    23149746    23836398    19892987    16341006    17975172    24813606    20010809    15489334    11585773    11733001    14561402    12923533    15107404    17942597    21183079    23853094    15057822    15632090    10349636    11042159    11076861    11217851    12466851    12040188    16141073    23385571    7862443    8673024    10542199    21709235    20798317    25243066    11506705    21993625    22751099    19340603    16305752    30297745    22398555    22722832    25362486    22002653    25319552    16136131    11181995    1714386    1653904    1717994    14702039    16541075    1396589    9030781    10499802    11051553    10995386    10995387    10884347    11113184    12185076    11980914    12839962    12944431    12972555    15178429    14597612    15611625    15800615    17373709    18691976    18372919    19829063    19369195    19690332    19608861    20147522    20079829    20360007    20935635    20195506    19966300    21269460    21406398    21262353    21684737    21596315    21319273    19445729    19238148    19561645    20713526    21517772    22814378    23781148    8510751    7630397    8601310    8917641    8684460    8756328    8610110    9334743    9677190    16325401    17570665    17495531    17095507    17937404    18656911    21565702    28666995    17344846    23711367    21347285    15592404    17635936    30382153    8280171    28562605    24621616    21881562   

EMBL

BABH01037322    JN833622    AFB82433.1    ODYU01001044    SOQ36702.1    GAIX01003535    + More
JAA89025.1    RSAL01000053    RVE50053.1    KZ150187    PZC72439.1    NWSH01000543    PCG75764.1    AGBW02013968    OWR42504.1    JTDY01000669    KOB76276.1    KQ435789    KOX74501.1    AFYH01001758    AFYH01001759    AJ224917    CAA12223.1    KZ288357    PBC27130.1    KQ760761    OAD59142.1    AAPE02026874    KE163877    EPQ14231.1    KB203827    ESO82954.1    KQ414657    KOC65758.1    KQ434850    KZC08564.1    AAGJ04171849    KB016734    EQB77761.1    AEMK02000033    JX967576    AGR86101.1    AAEX03006916    AANG04003655    ACTA01178059    GL192457    EFB28834.1    AAQR03076828    AAQR03076829    U63337    AJ223732    AJ223733    BC005654    AC098012    AC141508    BC061832    CH474104    AAH61832.1    EDL84822.1    AK152922    CH466578    BAE31597.1    EDL24600.1    KB364768    ELV12032.1    D28753    D63162    AEFK01203592    GL440609    EFN65646.1    AGTP01085299    AGTP01085300    JH431734    GAMT01001273    GAMS01008093    GAMQ01007798    JAB10588.1    JAB15043.1    JAB34053.1    AJ223949    AAKN02014842    JH169329    GEBF01002266    EHB06556.1    JAO01367.1    JH882551    ELR48983.1    FJ422550    ACJ53943.1    LWLT01000005    EF035041    ABK34941.1    BT020790    BC150026    BFAA01003391    GCB70959.1    CABD030083632    AQIB01023022    AJFE02087845    AHZZ02002258    ABGA01042610    ABGA01042611    NDHI03003457    PNJ44889.1    AQIA01011136    CM001286    EHH66383.1    JU320958    JU473899    JV045857    CM001263    AFE64714.1    AFH30703.1    AFI35928.1    EHH20842.1    AACZ04012961    GABC01007850    GABF01000440    GABD01001183    GABE01004554    NBAG03000092    JAA03488.1    JAA21705.1    JAA31917.1    JAA40185.1    PNI90081.1    CH471054    EAW96860.1    X61622    X62071    M68520    AB012305    BT006821    AF512553    AK291941    AC025162    AC034102    BC003065    ADTU01020711    ADTU01020712    AADN05000742    EF182713    ABM55710.1    KQ981689    KYN37898.1    RCHS01000860    RMX56356.1    D17350    AANG04004184    MCFN01001318    OXB53259.1    AWGT02008165    OXB56521.1    KQ981010    KYN10338.1    AEMK02000080    KQ976593    KYM79677.1    BEZZ01000169    GCC27553.1    AAWZ02011909   

Proteomes

UP000005204    UP000283053    UP000218220    UP000007151    UP000037510    UP000053105    + More
UP000008672    UP000242457    UP000005203    UP000001074    UP000030746    UP000053825    UP000076502    UP000007646    UP000007110    UP000008227    UP000248481    UP000002281    UP000002254    UP000252040    UP000286641    UP000265300    UP000011712    UP000245341    UP000248482    UP000286640    UP000248483    UP000245340    UP000261681    UP000291022    UP000286642    UP000261680    UP000291021    UP000008912    UP000005225    UP000248484    UP000233160    UP000081671    UP000000589    UP000002494    UP000248480    UP000011518    UP000007648    UP000000311    UP000005215    UP000233020    UP000233040    UP000008225    UP000189706    UP000005447    UP000006813    UP000291000    UP000009136    UP000288216    UP000189704    UP000233120    UP000233180    UP000001519    UP000233140    UP000029965    UP000240080    UP000028761    UP000233200    UP000233060    UP000233080    UP000001595    UP000009130    UP000233100    UP000002277    UP000005640    UP000005205    UP000000539    UP000078541    UP000275408    UP000291020    UP000198323    UP000198419    UP000078492    UP000078540    UP000287033    UP000001646    UP000079721   

PRIDE

H6VMF4    P97377    Q63699    O55076    Q5E9Y0    A0A024RB77    + More
P24941    P48963    F1RW06   

Pfam

PF00069   Pkinase        + More
PF15490   Ten1_2

Interpro

IPR000719   Prot_kinase_dom        + More
IPR017441   Protein_kinase_ATP_BS       
IPR008271   Ser/Thr_kinase_AS       
IPR011009   Kinase-like_dom_sf       
IPR029146   Ten1_animal_plant       

SUPFAM

SSF56112   SSF56112       

ProteinModelPortal

H6VMF4   A0A2H1V8G8   S4PMI6   A0A437BI96   A0A2W1BA74   A0A2A4JVV4   + More
A0A212ELY3   A0A0L7LM44   A0A0N0U5C0   H3BI57   O46161   A0A2A3E5Z8   A0A087ZNC2   A0A310SE63   G1P317   S7NB09   V4B3L0   A0A0L7R4I8   A0A154PB06   G3TH75   W4XW48   T0MEU0   A0A287AXP1   A0A2Y9GUJ7   F6US96   E2QW70   A0A341AR07   A0A3Q7RF90   A0A340Y2B2   A0A2I2V4K7   A0A2U3XBV5   A0A2Y9L521   A0A3Q7SQ67   A0A2Y9NEE7   A0A2U3W1B4   A0A383ZXG1   A0A452RHR8   A0A3Q7X0F6   A0A384DTG0   D2H336   H0WVH2   A0A2Y9FRU8   A0A2K6GY84   A0A1S3FMH0   P97377-2   Q6P751   Q3U6X7   A0A2Y9DS22   L8Y724   Q63699   G3W161   E2ALN7   I3LWC0   T1J0E3   A0A2K5DF40   A0A2K5QXK8   F7BWH8   A0A1U8C8E6   O55076   A0A286XH18   G5BB95   L8HYF4   B7U171   A0MSV8   Q5E9Y0   A0A401PCX1   A0A1U7U8H5   A0A2K6E4W9   A0A2K6MMD4   G3QIR0   A0A2K5XCR8   A0A0D9QZ04   A0A2R9B4E4   A0A096MYH8   A0A2K6P9I2   A0A2K5NT27   A0A2K5IHJ1   H2NHM8   G7PIG0   G7N7A7   H2Q670   A0A024RB77   P24941   A0A158NMZ5   A0A2Y9GC92   A2IAR9   A0A151JVM2   A0A3M6URQ2   P48963   M3W4N5   A0A452GT32   A0A2Y9GF67   A0A226MDZ0   A0A226MMP6   A0A195DBS4   F1RW06   A0A151I170   A0A401SB05   H9GA76   A0A1S3ALH3  

KEGG

101738936    K02206 cyclin-dependent kinase 2 [EC:2.7.11.22] | (RefSeq) CDK2; cyclin-dependent kinase 2

PATHWAY

04068    FoxO signaling pathway - Bombyx mori (domestic silkworm)

GO

GO:0004674   GO:0005524   GO:0051301   GO:0019904   GO:0008284   GO:0097134   GO:0000781   GO:0005768   GO:0030332   GO:0060968   GO:0000287   GO:0005667   GO:0000805   GO:0032298   GO:0000122   GO:0007265   GO:0035173   GO:0000806   GO:0007099   GO:0005813   GO:0015030   GO:0045893   GO:0018105   GO:0097124   GO:0006813   GO:0004693   GO:0000082   GO:0000793   GO:0097123   GO:0097135   GO:0005634   GO:0000307   GO:0006468   GO:0005737   GO:0010389   GO:0016572   GO:0006281   GO:0044877   GO:0097472   GO:0043231   GO:0005654   GO:0005829   GO:0032869   GO:0004672   GO:0051321   GO:0051591   GO:0016301   GO:0051602   GO:0046686   GO:0045471   GO:0005815   GO:0046872   GO:0032355   GO:0002088   GO:0031100   GO:0042493   GO:0009636   GO:0030496   GO:0000086   GO:0071732   GO:0006260   GO:0006977   GO:0031571   GO:0031145   GO:0051298   GO:1901796   GO:0006974   GO:0003697   GO:1990879   GO:0046982   GO:0005615   GO:0005515   GO:0016021   GO:0045211   GO:0048384  

Subcellular location

Cytoplasm   Localized at the centrosomes in late G2 phase after separation of the centrosomes but before the start of prophase. Nuclear-cytoplasmic trafficking is mediated during the inhibition by 1,25-(OH)(2)D(3) (By similarity).   With evidence from 2 publications.
Cytoskeleton   Localized at the centrosomes in late G2 phase after separation of the centrosomes but before the start of prophase. Nuclear-cytoplasmic trafficking is mediated during the inhibition by 1,25-(OH)(2)D(3) (By similarity).   With evidence from 2 publications.
Microtubule organizing center   Localized at the centrosomes in late G2 phase after separation of the centrosomes but before the start of prophase. Nuclear-cytoplasmic trafficking is mediated during the inhibition by 1,25-(OH)(2)D(3) (By similarity).   With evidence from 2 publications.
Centrosome   Localized at the centrosomes in late G2 phase after separation of the centrosomes but before the start of prophase. Nuclear-cytoplasmic trafficking is mediated during the inhibition by 1,25-(OH)(2)D(3) (By similarity).   With evidence from 2 publications.
Nucleus   Localized at the centrosomes in late G2 phase after separation of the centrosomes but before the start of prophase. Nuclear-cytoplasmic trafficking is mediated during the inhibition by 1,25-(OH)(2)D(3) (By similarity).   With evidence from 2 publications.
Cajal body   Localized at the centrosomes in late G2 phase after separation of the centrosomes but before the start of prophase. Nuclear-cytoplasmic trafficking is mediated during the inhibition by 1,25-(OH)(2)D(3) (By similarity).   With evidence from 2 publications.
Endosome   Localized at the centrosomes in late G2 phase after separation of the centrosomes but before the start of prophase. Nuclear-cytoplasmic trafficking is mediated during the inhibition by 1,25-(OH)(2)D(3) (By similarity).   With evidence from 2 publications.

Length:

302

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.0643299999999999

Exp number, first 60 AAs:

1e-05

Total prob of N-in:

0.02863

outside

1  -  302

 

 

Pi

40.983936

Theta

33.996669

Tajima's D

-2.236398

CLR

1.164567

CSRT

0.00454977251137443

Interpretation

Uncertain