SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03163
Pre Gene Modal
BGIBMGA002022
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Mitochondrial   Reliability : 1.129 Nuclear   Reliability : 1.818
 

Sequence

CDS
ATGCAGTCCGAAGCTACCGACGACGTGCTACTGGGAGGAACCTACCGTGTAGGAGTGAAGACGCCTAAGTTCAACCCCGAAGACCCAGAACTGTGGTTCGCTCAGCTGGAAGGGCAGTTCACCTTGTCCAATATAAGCGTAGACGCCACGAAGTTCTACTACGTGTTGTCGCAACTGGAACCGCAGCATGCAGCAGAAATCCGGGAGTTGATCGTGTCACCTCCAGCCACCAACAAATATGAGACGATCAAACATGAACTCATACGGAGATTATCAGCTTCGCAAGAAAAGAAGATTAAGCAATTGTTGATGCATGAGGAGATGGGAGATCGCAAACCTACACAGTTCCTTCGACACCTGCAGCTTCTGGCCGGAGAAAATGTTCCGAGCGACTTCATCCGCACCATCTGGGCAAGTCGCTTACCTACTCATCTGCAGACATGCATAGCAGCGCAGCAAACTAAGATGTCGCTAGAAGATTTAGCCGAACTTGCAGATCGTGTCAATGATGTCGTTCCAGTAACCATGCAAGTAGCAAGTCAAGTAGCCAGTTTGTCAACATCTGCAGTCATACCAAGCACCATTGACGCGTTGACCCGTAAAGTGGAGGAACTCAGTCGAAAACTCGAGACTATGACCAATGGATCAATCATATCCACCTACGGTGACCTGCCTCTTACGCTGGACTTAGGACTACGACGTAGTTTCACTTGGCGTTTCGTCGTAGCAGATGTGACGAAGCCTATCATCGGTGTCGACTTCCTAGGTTACTATAGCCTACTAGTCGATTGCCGCAATCAACGCCTGATCGATGGCATTACAGCACTTACTGTTGCCGCACCAACAAACAATTCAACAGAGGCAATTTCATCCGTTCGCACCACTACGGACAACTCGGTATACCATCAACTGCTGAGAGAGTATCCAGATGTCACCCGTCCTGCTGGTAGACAGTGCAATATCGTGCAGCATTCGACTGTCCACCACATACGAACTACCGCAGGCCCGCCAGTTTCCAGTCGTCCTCGGCGCTTAGATCCGGAACGTCTGAAAATTGCAAAAAAGGAATTTGATCAAATGTTGCAGGATGGAACAGCACGCAGATCCGACAGCCCGTGGTCCTCGCCTCTTCACTTAGTCCGCAAGAAGGACGATGGTTGGCGTCCATGTGGAGACTATAGGATGTTGAACGCACGCACGATACCTGATCAATATCCCGTGAGGCACTTGCAAGACTTCACGCAGCAACTCACAGGCAGCGCCATCTATTCAACAATTGACCTCGTCAAGGCCTACAACCAAATTCCGGTTTTTGAAGAGGACATACCGAAAACTGCCATAACAACACCATTTGGGTTATACGAATTCCCATTCATGACGTTTGGTCTTCGTAACGCCGCTCAAACGTTCCAGCGTTTTATGGATGAAGTTCTGCGAGGATTAGATTTCTGCTATGCTTATCTTGATGATATTTTAGTCAGTAGCAGTAGCAGCCACCAACATCAAGACCACCTTAAACAGCTTTTCAAAAGACTGTCAGATTATGGAGTTCTGATAAACACCAACAAGTGTGTATTTGGCCAACCAGAGGTGCAGTTCCTGGGATACAAAGTTTCTGCAGCAGGCGTTAAGCCACTAGAAAGCAAGGTCCAAGCTATCAAGGATTTTCCTACCCCCAGAACTGTCAAAGAATTGAGACGCTTTTTGGGCATGTTGAATTTTTATCACCGCTTCGTGCCAGCCGCAGCTTCCATTCAAGCGCCTCTCAACAGCTTACTTGCTGGTCCTAAAATCAAAGGATCACATCCTATAACCTTGACAGCGGAACATTTAGAAGCTTTCGAAAACTGCAAGAGGAGTTTGTCGGAAGCCACACTGTTAGTTCACCCAGATCCGAAGGCTGAGCTATCGATCCATACTGATGCATCAGACACCGCCATCGGAGGTGTATTACAACAGCTGAACGGTCAAGAATGGCAACCTCTGGCTTTCTTTTCTAAAAAGCTGAGCCCTTCGCAGAAGAAGTATAGTCCATACGACCGTGAACTTTTAGCTATCTATGAGGCTATACGTTACTTCAGATTCATGGTGGAAGCACGAGTTTTTTCTGTCGTAACAGATCATAAGCCGCTTACCTTCGCCTTCGCAACCAACCGCGAAAACTGCTCTCCACGGCAATTTCGTTACCTTGATTATATCAACCAATTCACTACGGATATACGGTATATCAAGGGAGAGGAAAATGTGGTAGCAGACACTCTTTCGAGGATTGAAGAGCTTACCCTTCCGTTAGACTATGAGTCACTGGCCAAAGAGCAAGAAACAGACGCCGAACTCCACGACTTACTGAGCAATGGATCCTCTCTGAAGCTGAAGAAACTCAAATTACCAGAGTCCACCACAGAAGTCTACTGCGACGTTACTGCGACACCACGACCTTTCATAACGCAGTCCTTTCGTAAGCAAGTTTTCTTAGCACTGCATAACCTGAGTCATCCAGGAGCGAAAGCTAGTGTCCAATTAGTAACACAAAGGTTTGTCTGGCCTGGAGTAAGGCGAGATTGTCGAAGCTGGGCTAAGCAGTGTGAAGCTTGTCAAAGAAGTAAAGTGAGCCGCCATACCTCCGCTCCTTTACGTGCTTTCAAACCACCATCAGCACGCTTCAGCCACATTCACCTCGACTTAATTGGACCACTGCCGGTATCCTGCAACTACCAGTACTGTCTCACCGTCATCGACCGCGCTACGCGTTGGCCTGAGGCATACCCGCTGCAGAACATCACCGCAGAAACGTGCGCTTCCGCTCTCACCACTGGATGGATATCACGTTTTGGTTGTCCTGAGCACATCACTACAGACCGTGGAAGGCAATTTGACTCCCAAACCTTCAGGGATTTAGCCGCCCTCATAGGTGCTACGCATCACCTCACCACGGCGTACCATCCCGCAGCCAACGGTCTCGTTGAGCGACTTCACCGCCAGCTAAAAGCCGCAATTATGTGCCACGCAGATTCCAGCTGGACGGAAGCACTTCCGTGGGTATTACTGGGAATACGCAGCGCCTGGAAAGAAGACCTAGGAGCATCCACAGCAGAACTTGTTTACGGTGAACCGCTCCGGTTACCTGGACAGTTTTTCACGTCGACGTCAGGAGATGTTGCAGACATGGGCAACCTAGTCAGCAGGTTGCGCACGCATATGTCGAAGTTAACGCCGCAACCCACATCATGGCATACAAGCTCGAGCCGACCCTTTTATGTCCCTAAAGACCTGAGAACAGCGACCCACGTCTTTCTGCGCCAAGGTCCAGCACGAAGATCGCTGCAAGCTCCATACTTGGGCCCATACAAAGTGCTACGTCGCGACGAAAAGACAGTGGACATCGAGGTTCAAGGAAAGACGCAGAAAGTCACAATTGACCGAGTCAAACCAGCTTATGTGGCACGAGAGGACCTCAACGCTAGTCAATCTAGGATCCAGAGTCCAAATCCGGTGACGCCTAAAGAACCAGTCAGGAAGACTAGGAAAAAGTCGCAATTCCCTTTGACTCTTTATCTGATTCATTTGTTCGTCAACTGGACGTGGACTCCTGTGTTCTTCGGACTCCATAAGCTTGGACTGGCTCTTCTACATATTGTGATATTGGATATACTAGCAGTGGGCTGCGCAATAAGCTTCTATATGGTCAACAGATGGGCAGCTGGCCTCTTCCTACCGTACATCGCGTGGTCAATATTTGCTACCTGCCTAACTGCTACTCTTTGGCATCTTAATTAA
Protein
MQSEATDDVLLGGTYRVGVKTPKFNPEDPELWFAQLEGQFTLSNISVDATKFYYVLSQLEPQHAAEIRELIVSPPATNKYETIKHELIRRLSASQEKKIKQLLMHEEMGDRKPTQFLRHLQLLAGENVPSDFIRTIWASRLPTHLQTCIAAQQTKMSLEDLAELADRVNDVVPVTMQVASQVASLSTSAVIPSTIDALTRKVEELSRKLETMTNGSIISTYGDLPLTLDLGLRRSFTWRFVVADVTKPIIGVDFLGYYSLLVDCRNQRLIDGITALTVAAPTNNSTEAISSVRTTTDNSVYHQLLREYPDVTRPAGRQCNIVQHSTVHHIRTTAGPPVSSRPRRLDPERLKIAKKEFDQMLQDGTARRSDSPWSSPLHLVRKKDDGWRPCGDYRMLNARTIPDQYPVRHLQDFTQQLTGSAIYSTIDLVKAYNQIPVFEEDIPKTAITTPFGLYEFPFMTFGLRNAAQTFQRFMDEVLRGLDFCYAYLDDILVSSSSSHQHQDHLKQLFKRLSDYGVLINTNKCVFGQPEVQFLGYKVSAAGVKPLESKVQAIKDFPTPRTVKELRRFLGMLNFYHRFVPAAASIQAPLNSLLAGPKIKGSHPITLTAEHLEAFENCKRSLSEATLLVHPDPKAELSIHTDASDTAIGGVLQQLNGQEWQPLAFFSKKLSPSQKKYSPYDRELLAIYEAIRYFRFMVEARVFSVVTDHKPLTFAFATNRENCSPRQFRYLDYINQFTTDIRYIKGEENVVADTLSRIEELTLPLDYESLAKEQETDAELHDLLSNGSSLKLKKLKLPESTTEVYCDVTATPRPFITQSFRKQVFLALHNLSHPGAKASVQLVTQRFVWPGVRRDCRSWAKQCEACQRSKVSRHTSAPLRAFKPPSARFSHIHLDLIGPLPVSCNYQYCLTVIDRATRWPEAYPLQNITAETCASALTTGWISRFGCPEHITTDRGRQFDSQTFRDLAALIGATHHLTTAYHPAANGLVERLHRQLKAAIMCHADSSWTEALPWVLLGIRSAWKEDLGASTAELVYGEPLRLPGQFFTSTSGDVADMGNLVSRLRTHMSKLTPQPTSWHTSSSRPFYVPKDLRTATHVFLRQGPARRSLQAPYLGPYKVLRRDEKTVDIEVQGKTQKVTIDRVKPAYVAREDLNASQSRIQSPNPVTPKEPVRKTRKKSQFPLTLYLIHLFVNWTWTPVFFGLHKLGLALLHIVILDILAVGCAISFYMVNRWAAGLFLPYIAWSIFATCLTATLWHLN

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01009142    KMQ88359.1    LBMM01012479    KMQ86204.1    LBMM01013040    KMQ85849.1    + More
AAGJ04112098    LBMM01013103    KMQ85815.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    AAGJ04001742    GBXI01015889    JAC98402.1    LBMM01012567    KMQ86146.1    LBMM01012160    KMQ86374.1    GBXI01017046    JAC97245.1    GEGO01003687    JAR91717.1    LBMM01012134    KMQ86388.1    GEGO01001281    JAR94123.1    GBXI01003773    JAD10519.1    KL363241    KFD51254.1    KL367552    KFD64647.1    LN877232    CTR11708.1    EF426679    ABP48077.1    GEGO01000286    JAR95118.1    AAGJ04130731    GFDL01003994    JAV31051.1    KL367492    KFD69854.1    MRZV01001828    PIK35719.1    GGFK01003442    MBW36763.1    GDHF01001116    JAI51198.1    GGFK01003401    MBW36722.1    GDHF01014424    JAI37890.1    GDHF01021808    JAI30506.1    GEGO01003506    JAR91898.1    GEGO01004484    JAR90920.1    GEGO01004686    JAR90718.1    LBMM01012633    KMQ86092.1    GDKW01003376    JAI53219.1    KQ973093    EFA13472.2    GGLE01001814    MBY05940.1    GEGO01004649    JAR90755.1    DF142933    GAA49140.1    ABLF02030693    ABLF02030697    LBMM01001181    KMQ96765.1    BK004070    DAA04500.1    GEDV01001796    JAP86761.1    CABG01000050    CAZ37786.2    KL367655    KFD60653.1    GEGO01004475    JAR90929.1    KQ971355    EFA07205.2    BK004066    DAA04495.1    GFPF01012375    MAA23521.1    BN000802    CAJ00250.1    AY013563    AAK07485.1    AY013565    AAK07486.1    ABLF02058233    GGLE01003443    MBY07569.1    AY013569    AAK07487.1    GBYB01009311    JAG79078.1    AAGJ04000250    GACK01008900    JAA56134.1    AAGJ04172791    KL367544    KFD65142.1    KL367778    KFD59660.1    AAZX01009606    QPMK01000035    RDD64024.1    KL367543    KFD65158.1    JYDT01000067    KRY86703.1    JYDR01000002    KRY79251.1    JWZT01004124    KII64665.1    JWZT01002058    KII70465.1    AAZX01006801    AAZX01023483    JYDO01000387    KRZ65366.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JWZT01003175    KII67485.1    KL367664    KFD60497.1    NIVC01003188    PAA52757.1    ABLF02011086    ABLF02042879    FN356213    CAX83702.1    AAZX01023279    ABLF02005645    ABLF02042063    KL363373    KFD46409.1    AAZX01013940    JYDJ01000353    KRX36608.1    ABLF02040931    ABLF02040938    FN356212    CAX83701.1    JWZT01001363    KII72172.1    AAZX01004786    KL367519    KFD67051.1    GGMR01005228    MBY17847.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR012337   RNaseH-like_sf       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR034132   RP_Saci-like       
IPR013032   EGF-like_CS       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
PDB
4OL8     E-value=2.36078e-69,     Score=671

Ontologies

Topology

Length:
1258
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
59.60728
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00123
outside
1  -  1179
TMhelix
1180  -  1202
inside
1203  -  1206
TMhelix
1207  -  1229
outside
1230  -  1232
TMhelix
1233  -  1255
inside
1256  -  1258
 
 

Population Genetic Test Statistics

Pi
200.388037
Theta
173.28524
Tajima's D
1.699769
CLR
0.259831
CSRT
0.830808459577021
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号