SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03141
Pre Gene Modal
BGIBMGA014553
Annotation
hypothetical_protein_TcasGA2_TC034914?_partial_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 2.51
 

Sequence

CDS
ATGGAGCGGGTAACTATAAGATACAAGGACGATACAAATAAACCATCAGAAATGGAGCAAAAGTTTGAAGCTTACAAAAAGGAGCAAGAAGAAAAGATCAGGAGACTAGAACAAGAAATTAAGGAACTTAAGACACTGCATAAACGCGAGACTGGAGAGAACCAACTTTTCAAGCTTGACGATCAGATGATTGACAGCTATGACGACTTCTCGAAAGTTTCAAGCATGGACTGGACGCAGGACAGTTACAAAAGGACAAAGATAGGCCATGGAGACATTTTCCTGAGAACCACCGACTGTATAGTCTACTTCTGTGATGAGAGGGAGAAAGCACACTCGAGGCTGACAAGGAGGGTGCTAAGCCGATATCCAGAAGTGACTAAGGGCGAGAAAATGGCATGCGCAGGAGGAGCATACGTGACGGTGGAACGAGAAACCACCATCAAAACAAAAGAGGGGAGACAGACAGACAAAACGAGTGCTGTGATCATGTTCCATGATGCGACCAAACAGGACGGCCGAAGTCAAAAGGACATGTATGAGCTTCTGTCAGAATTAACCAAAATAGTGGAAGAGATGGGAAACAAAGAGCTAACGATTATAAAGCCCCAAGGAATCGATACAGGTGTAACAAGGAAGATGTTAGAAGTACTGTTCCGTGGAAAGGACATCAAACTAGAATTAAGGACACCTAAAAAAGGAGAAAATACAAACAATACGGAAACAAGAAAACGGGACGAGGTAATAGTCATAGAAGGAGGGACAACTACTTATGCGGACACCGTAAAGAGGCTAAAAGAAGGAATAAAAGGGACCGCATCCCTAGAAAACATAAAAGGTGTAAAAAAGACAGCCAAGGGACAAGTACTGGTAAGAGTGATGGGAAATATTGAGGAGATGACAGGGAAAATAAGAGAAATGATGCGAGACAGAAAGGTAAGAAGAACTGGGGGGAGCAAAAAAAAAGTAATACACATAAAGGGAATGGACAGCTCGGTGGAAATGGAGGAAGTAAGGGAGGACTTAAAGTCGACAAACTTGATAAAAAAAGTAGACAGCTTGGAGATAAGATCACTGAGACCGATGGGCGGTGGAAACCAGACGGCAACAGTGATCCTGGATGAAGAGGATGCAGGAAGGCTGCTTGCGGGTGGGAAGATAAGAGTAGGGCTAAATATATGCCACATTCATGAAAGAATTGAACTGCTGAGATGCTACCGGTGCTGGGAATATGGCCACAAAGCGGAAAACTGCAACGTAAAAAAGGACACACAGCTGGCACCGGTAGATGCCCACTCTTCCGGGAGGCATTGGAAACCGCGAAGCGAAGTCAAACCTATAACAAAAATGGTTTTTAAAGTGTTACAGATAAATATAGACCGAGGGAAAGCCGCGCACGACCTACTTCTGGCAACTGCGAGCAAAATGAAAGCGGATCTCGTGATGCTAGCTGAACCCAATAGAAAGCTGGCAAAAGCTGCTGGATGGGAGTGCGACACCAGGGGAGATGCAGCCCTAGTGATTCTTAATAAAACACTGACGGTTTCTGAAATTTATAGGGGGAAGGGATTTGTTGGGTTCAAGATGAAGCACTTTGCCGCGTTCAGCTGTTACATATCTCCCAACTGCAGTTTTGAGGAGTTCAAAGCTGACGTCGATGAGCTTTGGACACTACTTAAAAAACAAAAGACACCGATCCTAGTGGCAGGAGATTTTAACTCTGCATCGAGAGCGTGGGGCAGTAAAGTAACCAACAAAAGGGGCCACTACCTGCTGGAAATGGTGGCGGACCTCGACACTGTCATCATGAATGAAGGCGTGACCCCAACTTTTGAAAGAGGAGACAGAACATCCAGGCCCGACATCACCATGGCCTCTGAAACGCTGGCAGGCAAGATCAGTAATTGGCAAGTGCTCGACGAGGAGACCATGAGCGGACATAAATATATAGCCTACGAGATAAAGCATGTATTGCCTCTATCCCAGTGCCATGCACAGATGAAAAGGTGGAACCTCCAAAGGCTGGACGTAGATAAGTTCAGTAAAAGCATGAAAGGAGCGCAGATCTCGACTCCCATGGAACTGGTGCAGGCTACGACGGCAGCGTGTGACGCTTCTATGCCAAAGCAAAACAACCGCAAGAAGAAAGGAGTCTACTGGTGGAACAAGGAAATTGCGGAAGCAAGGAAGGAGTGTTTGAAATGCCGAAGGAAGTACACAAGGAATAACAAAAAGCTAGGAAAAGGGAAAGACAGGGAAAGTAACGAAGAAAATGAACACAAAAAGCAGTATAAGGAAGCGAAACTGGAGCTACAAAGACGAATATGGAAAGCGAAAGACGATAAATGGAGGGAAGTGTGCGAGGAAGTCGACAATGATATATGGGGACTGGGATACAAAATAGTGTCAAAAAAGCTACGCGGAAACTCACCGATAAATATGGGCATGGCCCAAATTCAAAGCATAGCTGATGGCCTCTTCCCGGAACACATAGATTTCGAACGGAAAACGAAACCGTCACAGGAGTTCCCAGAGGTGACCGAGGAGGAGATCATCCAACTAAAAGCTCGCATAAAGCTCAGGAAAGCCCCAGGGCCCGACCGGATACCGCCGGAGATAGTGACTCTAGCAGTAGCAGTAATTCCAGACAGGATAAGGTTTGTGTTGCAGAAGGTGCTGGAGTCTGGCGTCTTCCCCAACAGCTGGAAAACAGCCAGACTAGTCCTGCTAAGAAAACCAGGCAAACCCGCTGAAGATCCTGCGGGGCACAGGCCGCTATGTCTACTGGACTGCTACGGAAAGCTGCTGGAGTCGCTGATCCTAGGCAGAATAGAAAAACAACTAGTGCAATCGGACTGTTTACAAGATTCACAGTACGGGTTCAGAAAGGGGAGGTCCACAGTGGATGCAGCCAACAAGCTACTTGAGATAGCGGAAGACGCGAGACGAGGAACCCACCGCACCAGAAGAATCTGCGCAGTAGTGGCCCTCGACGTCCGAAATGCTTTCAATTCTGCATCGTGGGAGCTCATCCTGGAGGAAATGGCTGCAATAGGTATGCCTCAATACATCTATAATATCATAAACAGCTACCTCCAGGACAGATGTATCATACTGACAGACGCCGAGGGAGGGGCTGTAGAGAAAAAGGTTACCGGTGGTGTTCCGCAGGGGTCGATACTGGGCCCCACGCTGTGGAACATACTCTATGATGGGGTACTGCGCCTCGAACTGGGGGACGGGGCAAAATTAATAGGCTTTGCTGACGATTTAGCTCTGGTGGTGTCAGCAAAGAAGGAAGCAGAACTGATGTCAATAACGAACGTAGCTCTAGAAAAGATCAGCGCTTGGATGAAGCAGAAGCGGCTACACTTGGCCCCAGAAAAGACCGAGGCAATTGTCTTAAGTGGGCGAAGGAAGCTGAGCGAGATCTGCTTTACCCTCCAGGGCGTCAGGGTGGTTCCAACCGACAAACTTAAATACCTTGGGTTGTGGTTTGACAAAAGTTTGAAGTTCGGTAAACACATTGAGGAAACAACGGGTAAAGCCGAAAGATTGACGGCCGCCCTTGGCCAAATTATGCCCAGAAAAGGAGGGCCGAGGTCAAGCAAGCGCAGACTATTGGCATCCGCGATACAATCTGTGATGTTATATGGAGCACCGGTGTGGGCAAGGGTAATGAATGTAGCGAAGTACAGGAACATGTATAGCAAAGTGCAACGACAGCTGGCAATACGCATCTGTGGAGCTTACCGTACCATATCGCTAGACGCCGTCTTGGTGATAGCGGGCCTGATACCGATAGAACGGCTAGCAAAGGAACGGCAACGCTACTACCACGAGGGGACAAGAACGAGAGAAGAGGAAAGAGCACATACAATAAAAGAATGGGAACGAGACTGGCAGAAGGAGGGAAAAGGTAAGTGGACTCGTACAATCATACCCAACCTTAGGCTCTGGATGGGACGGAAACATGGCGAAACCGACAGACTGCTGACACAGGCCCTAAGTGGGCATGGAGTTTTCAACACTTACCTGCATGCAATAGGGAAAGCAGAAAGCGCAAGTTGTCCATACTGCGAACATGTTGACACACCGGAACATGCCCTATTTCAATGCATAAAGTTCTCAGAACTAAGAGAGAAAACGGAAGGAAGTGACGGAAAGGTGACTGTGGAAAACCTGATGGTGAGAATGATCCATAGTAAAGAGGAATGGGATAAATATGCGGGAATGCTCAAAGAGATAATGAGAGTGCGGGAAAAGGACGAAAGACTAAGGCAAGAATCTACCTAA
Protein
MERVTIRYKDDTNKPSEMEQKFEAYKKEQEEKIRRLEQEIKELKTLHKRETGENQLFKLDDQMIDSYDDFSKVSSMDWTQDSYKRTKIGHGDIFLRTTDCIVYFCDEREKAHSRLTRRVLSRYPEVTKGEKMACAGGAYVTVERETTIKTKEGRQTDKTSAVIMFHDATKQDGRSQKDMYELLSELTKIVEEMGNKELTIIKPQGIDTGVTRKMLEVLFRGKDIKLELRTPKKGENTNNTETRKRDEVIVIEGGTTTYADTVKRLKEGIKGTASLENIKGVKKTAKGQVLVRVMGNIEEMTGKIREMMRDRKVRRTGGSKKKVIHIKGMDSSVEMEEVREDLKSTNLIKKVDSLEIRSLRPMGGGNQTATVILDEEDAGRLLAGGKIRVGLNICHIHERIELLRCYRCWEYGHKAENCNVKKDTQLAPVDAHSSGRHWKPRSEVKPITKMVFKVLQINIDRGKAAHDLLLATASKMKADLVMLAEPNRKLAKAAGWECDTRGDAALVILNKTLTVSEIYRGKGFVGFKMKHFAAFSCYISPNCSFEEFKADVDELWTLLKKQKTPILVAGDFNSASRAWGSKVTNKRGHYLLEMVADLDTVIMNEGVTPTFERGDRTSRPDITMASETLAGKISNWQVLDEETMSGHKYIAYEIKHVLPLSQCHAQMKRWNLQRLDVDKFSKSMKGAQISTPMELVQATTAACDASMPKQNNRKKKGVYWWNKEIAEARKECLKCRRKYTRNNKKLGKGKDRESNEENEHKKQYKEAKLELQRRIWKAKDDKWREVCEEVDNDIWGLGYKIVSKKLRGNSPINMGMAQIQSIADGLFPEHIDFERKTKPSQEFPEVTEEEIIQLKARIKLRKAPGPDRIPPEIVTLAVAVIPDRIRFVLQKVLESGVFPNSWKTARLVLLRKPGKPAEDPAGHRPLCLLDCYGKLLESLILGRIEKQLVQSDCLQDSQYGFRKGRSTVDAANKLLEIAEDARRGTHRTRRICAVVALDVRNAFNSASWELILEEMAAIGMPQYIYNIINSYLQDRCIILTDAEGGAVEKKVTGGVPQGSILGPTLWNILYDGVLRLELGDGAKLIGFADDLALVVSAKKEAELMSITNVALEKISAWMKQKRLHLAPEKTEAIVLSGRRKLSEICFTLQGVRVVPTDKLKYLGLWFDKSLKFGKHIEETTGKAERLTAALGQIMPRKGGPRSSKRRLLASAIQSVMLYGAPVWARVMNVAKYRNMYSKVQRQLAIRICGAYRTISLDAVLVIAGLIPIERLAKERQRYYHEGTRTREEERAHTIKEWERDWQKEGKGKWTRTIIPNLRLWMGRKHGETDRLLTQALSGHGVFNTYLHAIGKAESASCPYCEHVDTPEHALFQCIKFSELREKTEGSDGKVTVENLMVRMIHSKEEWDKYAGMLKEIMRVREKDERLRQEST

Summary

EMBL
KQ971388    KYB24913.1    KQ971310    KYB29500.1    KYB29499.1    KQ972691    + More
KXZ75806.1    ABLF02041886    KQ972544    KXZ75869.1    KXZ75807.1    KXZ75870.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02011183    ABLF02041884    ABLF02018942    ABLF02041885    KXZ75805.1    KU543683    AMS38371.1    GGFK01005660    MBW38981.1    GAKP01002292    JAC56660.1    GGMR01006838    MBY19457.1    GGFJ01001369    MBW50510.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GGFJ01001370    MBW50511.1    KU543682    AMS38369.1    ABLF02018808    GFXV01002090    MBW13895.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    ABLF02007989    GGFL01004046    MBW68224.1    GGFL01004047    MBW68225.1    ABLF02009073    ABLF02030702    ABLF02042963    GGFJ01001164    MBW50305.1    GGFJ01001165    MBW50306.1    GGFM01001554    MBW22305.1    ABLF02004854    ABLF02041317    AB090814    BAC57904.1    GGFJ01001166    MBW50307.1    ABLF02018098    ABLF02011238    GGFK01007771    MBW41092.1    AB090812    BAC57900.1    ABLF02030663    ABLF02041312    ABLF02027248    ABLF02023257    AB090813    BAC57902.1    M93690    AAA29363.1    GGFL01001192    MBW65370.1    GGMR01012748    MBY25367.1    AB090821    BAC57918.1    AB090820    BAC57916.1    AB090822    BAC57920.1    ABLF02021645    ABLF02020969    AB090823    BAC57922.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00098   zf-CCHC
PF00075   RNase_H
PF13966   zf-RVT
Interpro
IPR000477   RT_dom        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000663   Natr_peptide       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR026960   RVT-Znf       
IPR016067   S-AdoMet_deCO2ase_core       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
SSF53098   SSF53098       
SSF56276   SSF56276       
Gene 3D
PDB
1WDU     E-value=8.52565e-13,     Score=184

Ontologies

Topology

Length:
1431
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
21.15954
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1431
 
 

Population Genetic Test Statistics

Pi
19.245201
Theta
26.642381
Tajima's D
-1.299103
CLR
118.363701
CSRT
0.0884455777211139
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号