Gene

KWMTBOMO03123

Pre Gene Modal

BGIBMGA005791

Annotation

PREDICTED:_adenosine_monophosphate-protein_transferase_FICD_homolog_[Bombyx_mori]

Location

Bomo_Chr5(-):18739729-18743092      View in EpiBrowser

Full name

Protein adenylyltransferase Fic      

Alternative Name

De-AMPylase Fic

Location in the cell

Mitochondrial   Reliability : 1.487 Nuclear   Reliability : 1.401

CDS

ATGTTGTACTTAGGTAAAACGAGCGAAGGCGAAAAAATGAAGTGTTCGTGCAAAAATGAAATATTCACCAAAATGATAGTGGATAAGTGCAGGACCGTAGTCATACTCTCTAGTATGGTGTGTACACTAGCTGTTGTTATATCTTTACACAAATTATTAACTTATGACATTAGAATTACCAAACCATTTTCCCCTATACCAGAAGGGCTGTACGGGAACTACTTAGAACCAATTTCAGATGAGAATCCCGTACCTATAGTACCTAAGGCACAAGATAAAGCTCGGGATGCGGAAGCTGTGGTGTCTTTAAATGCTGCATTAGAAATGAAGAAACATGGAAAGTCCGACAAAGCATTAAAATTATTTCAACATGCATTCGCTCTGTCACCAAAACATGCAGATATTTTAAATCACTATGGAGAGTTCTTAGAAGATACTAAAAAAGATATAGTAAAAGCAGACCAGCTTTATACATTAGCTTTAACTAATTACCCTGATCACACTGGTGCTTTAACGAACAGACAAAGAACAGCCAGCATTGTTGAAAACTTAGACAGAGAAATGTTGAGGAAAATTGATGATAAAAGAGATGCACTATCTTCAATACCAGAAAACAATTCAGCATTACGAAGAGCAAAAAAGGAGGCATATTTCCAACATATTTATCACACAGTAGCCATAGAAGGTAATACAATGACATTGCAACAAACAAGAAGTATTCTAGAGACTCGGATTGCTATATCGGGCAAAAGCATAGATGAGCACAATGAAATTCTAGGCTTAGATGCAGCAATGAAGTACATAAATTCTACACTTCTGTACAGATTACGAGACATAACCATGGGTGATATTCTTGAGATTCATAAGAGGGTGTTAGGGCATGTAGACCCAGTGGAAGGAGGGAACTTCCGCAGAACACAGGTGTATGTTGGTGGTCACATTCCACCTGGCCCCTTAGAGATCCAAGGCCTAATGATACAGTTTATGGAATGGCTTAACTCTGAAGATGCTTTGGATTTACATCCAGTAAGGTACGCAGCCCTGGCGCACTACAAACTAGTGCACATCCACCCGTTCGTGGACGGCAACGGACGCACGTCGCGGCTCCTCATGAACCTGCTGCTGATGCAGGCCGGATACCCCCCCGTCATCATCGCGAAACAACACCGCCACCTTTACTACCAGCATTTGCAGACCGCTAACGAGGGAGATGTTAGACCTTTTGTTAGGTTTATAGCACAATCAACAGAGCGAACTCTAAACCTGTACCTGTGGGCGACCAGCGAGTTCTCCCACACGGTCCCGGCCATCGGCAAACCTCATATACTTACCGAAGATGAATTCGACGATACAATTCTCTGA

Protein

MLYLGKTSEGEKMKCSCKNEIFTKMIVDKCRTVVILSSMVCTLAVVISLHKLLTYDIRITKPFSPIPEGLYGNYLEPISDENPVPIVPKAQDKARDAEAVVSLNAALEMKKHGKSDKALKLFQHAFALSPKHADILNHYGEFLEDTKKDIVKADQLYTLALTNYPDHTGALTNRQRTASIVENLDREMLRKIDDKRDALSSIPENNSALRRAKKEAYFQHIYHTVAIEGNTMTLQQTRSILETRIAISGKSIDEHNEILGLDAAMKYINSTLLYRLRDITMGDILEIHKRVLGHVDPVEGGNFRRTQVYVGGHIPPGPLEIQGLMIQFMEWLNSEDALDLHPVRYAALAHYKLVHIHPFVDGNGRTSRLLMNLLLMQAGYPPVIIAKQHRHLYYQHLQTANEGDVRPFVRFIAQSTERTLNLYLWATSEFSHTVPAIGKPHILTEDEFDDTIL

Description

Protein that can both mediate the addition of adenosine 5'-monophosphate (AMP) to specific residues of target proteins (AMPylation), and the removal of the same modification from target proteins (de-AMPylation), depending on the context (By similarity). The side chain of Glu-255 determines which of the two opposing activities (AMPylase or de-AMPylase) will take place (By similarity). Acts as a key regulator of the unfolded protein response (UPR) by mediating AMPylation or de-AMPylation of Hsc70-3/BiP. In unstressed cells, acts as an adenylyltransferase by mediating AMPylation of Hsc70-3/BiP at 'Thr-518', thereby inactivating it. In response to endoplasmic reticulum stress, acts as a phosphodiesterase by mediating removal of ATP (de-AMPylation) from Hsc70-3/BiP at 'Thr-518', leading to restore HSPA5/BiP activity (By similarity).
Protein that can both mediate the addition of adenosine 5'-monophosphate (AMP) to specific residues of target proteins (AMPylation), and the removal of the same modification from target proteins (de-AMPylation), depending on the context (By similarity). The side chain of Glu-251 determines which of the two opposing activities (AMPylase or de-AMPylase) will take place (By similarity). Acts as a key regulator of the unfolded protein response (UPR) by mediating AMPylation or de-AMPylation of Hsc70-3/BiP. In unstressed cells, acts as an adenylyltransferase by mediating AMPylation of Hsc70-3/BiP at 'Thr-518', thereby inactivating it. In response to endoplasmic reticulum stress, acts as a phosphodiesterase by mediating removal of ATP (de-AMPylation) from Hsc70-3/BiP at 'Thr-518', leading to restore HSPA5/BiP activity (By similarity).
Protein that can both mediate the addition of adenosine 5'-monophosphate (AMP) to specific residues of target proteins (AMPylation), and the removal of the same modification from target proteins (de-AMPylation), depending on the context (By similarity). The side chain of Glu-250 determines which of the two opposing activities (AMPylase or de-AMPylase) will take place (By similarity). Acts as a key regulator of the unfolded protein response (UPR) by mediating AMPylation or de-AMPylation of Hsc70-3/BiP. In unstressed cells, acts as an adenylyltransferase by mediating AMPylation of Hsc70-3/BiP at 'Thr-518', thereby inactivating it. In response to endoplasmic reticulum stress, acts as a phosphodiesterase by mediating removal of ATP (de-AMPylation) from Hsc70-3/BiP at 'Thr-518', leading to restore HSPA5/BiP activity (By similarity).
Protein that can both mediate the addition of adenosine 5'-monophosphate (AMP) to specific residues of target proteins (AMPylation), and the removal of the same modification from target proteins (de-AMPylation), depending on the context (By similarity). The side chain of Glu-236 determines which of the two opposing activities (AMPylase or de-AMPylase) will take place (By similarity). Acts as a key regulator of the unfolded protein response (UPR) by mediating AMPylation or de-AMPylation of Hsc70-3/BiP. In unstressed cells, acts as an adenylyltransferase by mediating AMPylation of Hsc70-3/BiP at 'Thr-518', thereby inactivating it. In response to endoplasmic reticulum stress, acts as a phosphodiesterase by mediating removal of ATP (de-AMPylation) from Hsc70-3/BiP at 'Thr-518', leading to restore HSPA5/BiP activity (By similarity).
Protein that can both mediate the addition of adenosine 5'-monophosphate (AMP) to specific residues of target proteins (AMPylation), and the removal of the same modification from target proteins (de-AMPylation), depending on the context (By similarity). The side chain of Glu-247 determines which of the two opposing activities (AMPylase or de-AMPylase) will take place (By similarity). Acts as a key regulator of the unfolded protein response (UPR) by mediating AMPylation or de-AMPylation of Hsc70-3/BiP. In unstressed cells, acts as an adenylyltransferase by mediating AMPylation of Hsc70-3/BiP at 'Thr-518', thereby inactivating it. In response to endoplasmic reticulum stress, acts as a phosphodiesterase by mediating removal of ATP (de-AMPylation) from Hsc70-3/BiP at 'Thr-518', leading to restore HSPA5/BiP activity (By similarity).
Protein that can both mediate the addition of adenosine 5'-monophosphate (AMP) to specific residues of target proteins (AMPylation), and the removal of the same modification from target proteins (de-AMPylation), depending on the context (PubMed:29089387). The side chain of Glu-247 determines which of the two opposing activities (AMPylase or de-AMPylase) will take place (By similarity). Acts as a key regulator of the unfolded protein response (UPR) by mediating AMPylation or de-AMPylation of Hsc70-3/BiP (PubMed:25395623, PubMed:29089387). In unstressed cells, acts as an adenylyltransferase by mediating AMPylation of Hsc70-3/BiP at 'Thr-518', thereby inactivating it (PubMed:29089387). In response to endoplasmic reticulum stress, acts as a phosphodiesterase by mediating removal of ATP (de-AMPylation) from Hsc70-3/BiP at 'Thr-518', leading to restore HSPA5/BiP activity (PubMed:29089387).
Protein that can both mediate the addition of adenosine 5'-monophosphate (AMP) to specific residues of target proteins (AMPylation), and the removal of the same modification from target proteins (de-AMPylation), depending on the context (By similarity). The side chain of Glu-261 determines which of the two opposing activities (AMPylase or de-AMPylase) will take place (By similarity). Acts as a key regulator of the unfolded protein response (UPR) by mediating AMPylation or de-AMPylation of Hsc70-3/BiP. In unstressed cells, acts as an adenylyltransferase by mediating AMPylation of Hsc70-3/BiP at 'Thr-518', thereby inactivating it. In response to endoplasmic reticulum stress, acts as a phosphodiesterase by mediating removal of ATP (de-AMPylation) from Hsc70-3/BiP at 'Thr-518', leading to restore HSPA5/BiP activity (By similarity).
Protein that can both mediate the addition of adenosine 5'-monophosphate (AMP) to specific residues of target proteins (AMPylation), and the removal of the same modification from target proteins (de-AMPylation), depending on the context (By similarity). The side chain of Glu-252 determines which of the two opposing activities (AMPylase or de-AMPylase) will take place (By similarity). Acts as a key regulator of the unfolded protein response (UPR) by mediating AMPylation or de-AMPylation of Hsc70-3/BiP. In unstressed cells, acts as an adenylyltransferase by mediating AMPylation of Hsc70-3/BiP at 'Thr-518', thereby inactivating it. In response to endoplasmic reticulum stress, acts as a phosphodiesterase by mediating removal of ATP (de-AMPylation) from Hsc70-3/BiP at 'Thr-518', leading to restore HSPA5/BiP activity (By similarity).

Catalytic Activity

ATP + L-tyrosyl-[protein] = diphosphate + O-(5'-adenylyl)-L-tyrosyl-[protein]
ATP + L-threonyl-[protein] = 3-O-(5'-adenylyl)-L-threonyl-[protein] + diphosphate
3-O-(5'-adenylyl)-L-threonyl-[protein] + H2O = AMP + H(+) + L-threonyl-[protein]

Subunit

Homodimer.
Homodimer; homodimerization may regulate adenylyltransferase and phosphodiesterase activities.

Similarity

Belongs to the fic family.

Keywords

ATP-binding   Complete proteome   Hydrolase   Membrane   Nucleotide-binding   Nucleotidyltransferase   Reference proteome   Repeat   TPR repeat   Transferase   Transmembrane   Transmembrane helix  

Feature

chain  Protein adenylyltransferase Fic

Uniprot

A0A2H1V6C4   A0A0L7LNN7   A0A2W1BIA5   A0A2A4J4N4   H9J8E9   A0A194PP13   + More
A0A0N0PBC2   A0A212EJ58   A0A0N0BJ80   A0A310SEF7   A0A2J7R3H1   A0A088A303   E9IB73   A0A2A3EA94   A0A0L7QXJ4   A0A195B6Z9   E2AZD6   A0A195CPH8   F4WG96   A0A158NI65   A0A151JX74   A0A026WTM1   A0A154P523   A0A195EGM3   E2C6W3   A0A067QSR1   A0A151WJE0   A0A182Y5M9   A0A1Q3F7G6   Q7Q1Y3   Q17A75   B0W429   A0A182PB18   A0A182RRG4   A0A1Q3F812   A0A1B6DIV6   A0A2M3Z7N7   A0A182IDX8   A0A182WHK6   A0A182UG26   A0A182LV45   A0A182K1B5   A0A182UYL7   A0A182NUZ1   A0A182XCJ8   A0A182F232   A0A2M3Z6Q4   A0A2M3Z6U7   A0A1A9XTP6   A0A1B0C7A9   A0A182Q5G9   A0A2M4BJ19   A0A2M4BJ35   A0A2M4BJ85   A0A084VDU0   A0A1B0FEY9   A0A182IQP3   A0A1A9X085   A0A1B6ESG1   A0A1A9V7F5   A0A1B6L271   A0A1A9Z5R5   A0A0L0BRZ8   E0VQJ4   A0A0K8TS66   A0A336KT82   A0A0K8UK48   A0A034VRR1   U5EIG0   A0A336MBF3   W8BKS6   B4P0E1   B3N5J3   A0A0A9WH54   B4JBN5   B4LQT7   B4KFW6   A0A3B0KD51   A0A0J9QXP8   B4I1V5   B4MUQ2   B4Q4M7   Q8SWV6   A0A0P4VN55   A0A1I8MML5   Q29JP8   B4GJC1   A0A1W4V8P6   A0A1I8NSW1   A0A1J1HT59   W5JQ21   B3MK83   A0A0P5K1N6   A0A0P4YAA9   A0A0P5GMF2   A0A165AFP9   A0A0P6BEX1   A0A0V0G742   A0A0M5IXU3   A0A0M4E0A6  

EC Number

2.7.7.n1

Pubmed

26227816    28756777    19121390    26354079    22118469    21282665    + More
20798317    21719571    21347285    24508170    30249741    24845553    25244985    12364791    17510324    24438588    26108605    20566863    26369729    25348373    24495485    17994087    25401762    22936249    10731132    12537572    12537569    19503829    25395623    29089387    27129103    25315136    15632085    20920257    23761445   

EMBL

ODYU01000919    SOQ36405.1    JTDY01000463    KOB77062.1    KZ150027    PZC74782.1    + More
NWSH01003247    PCG66696.1    BABH01027325    KQ459597    KPI95171.1    KQ460970    KPJ10185.1    AGBW02014532    OWR41500.1    KQ435719    KOX78804.1    KQ770178    OAD52675.1    NEVH01007819    PNF35388.1    GL762111    EFZ22212.1    KZ288322    PBC28212.1    KQ414704    KOC63330.1    KQ976579    KYM80035.1    GL444207    EFN61175.1    KQ977481    KYN02397.1    GL888128    EGI66863.1    ADTU01016347    KQ981578    KYN39744.1    KK107111    QOIP01000011    EZA59011.1    RLU17244.1    KQ434809    KZC06424.1    KQ978957    KYN27047.1    GL453216    EFN76317.1    KK869029    KDR12881.1    KQ983039    KYQ47972.1    GFDL01011539    JAV23506.1    AAAB01008980    EAA13788.4    CH477339    DS231834    GFDL01011402    JAV23643.1    GEDC01011711    JAS25587.1    GGFM01003795    MBW24546.1    APCN01004537    AXCM01001697    GGFM01003434    MBW24185.1    GGFM01003473    MBW24224.1    JXJN01027972    AXCN02000753    GGFJ01003925    MBW53066.1    GGFJ01003924    MBW53065.1    GGFJ01003923    MBW53064.1    ATLV01011788    KE524721    KFB36134.1    CCAG010008989    GECZ01028887    JAS40882.1    GEBQ01022343    JAT17634.1    JRES01001455    KNC22773.1    DS235430    EEB15650.1    GDAI01000612    JAI16991.1    UFQS01000861    UFQT01000861    SSX07342.1    SSX27684.1    GDHF01025393    JAI26921.1    GAKP01014165    GAKP01014162    GAKP01014160    JAC44792.1    GANO01002662    JAB57209.1    SSX07340.1    SSX27682.1    GAMC01016391    JAB90164.1    CM000157    CH954177    GBHO01035827    GBRD01006244    JAG07777.1    JAG59577.1    CH916368    CH940649    CH933807    OUUW01000010    SPP86170.1    CM002910    KMY88514.1    CH480820    CH963857    CM000361    AE014134    AY095059    GDKW01002277    JAI54318.1    CH379062    CH479184    CVRI01000020    CRK90564.1    ADMH02000487    ETN66236.1    CH902620    GDIQ01191008    JAK60717.1    GDIP01231280    JAI92121.1    GDIQ01239654    GDIQ01036861    JAK12071.1    LRGB01000626    KZS17582.1    GDIP01030345    JAM73370.1    GECL01002596    JAP03528.1    CP012523    ALC37998.1    ALC38491.1   

Proteomes

UP000037510    UP000218220    UP000005204    UP000053268    UP000053240    UP000007151    + More
UP000053105    UP000235965    UP000005203    UP000242457    UP000053825    UP000078540    UP000000311    UP000078542    UP000007755    UP000005205    UP000078541    UP000053097    UP000279307    UP000076502    UP000078492    UP000008237    UP000027135    UP000075809    UP000076408    UP000007062    UP000008820    UP000002320    UP000075885    UP000075900    UP000075840    UP000075920    UP000075902    UP000075883    UP000075881    UP000075903    UP000075884    UP000076407    UP000069272    UP000092443    UP000092460    UP000075886    UP000030765    UP000092444    UP000075880    UP000091820    UP000078200    UP000092445    UP000037069    UP000009046    UP000002282    UP000008711    UP000001070    UP000008792    UP000009192    UP000268350    UP000001292    UP000007798    UP000000304    UP000000803    UP000095301    UP000001819    UP000008744    UP000192221    UP000095300    UP000183832    UP000000673    UP000007801    UP000076858    UP000092553   

PRIDE

H9J8E9    Q17A75    B0W429    B4P0E1    B3N5J3    B4JBN5    + More
B4KFW6    B4I1V5    B4MUQ2    B4Q4M7    Q8SWV6    B4GJC1   

Pfam

PF02661   Fic        + More
PF15275   PEHE

Interpro

IPR003812   Fido        + More
IPR036597   Fido-like_dom_sf       
IPR040198   Fido_containing       
IPR019734   TPR_repeat       
IPR011990   TPR-like_helical_dom_sf       
IPR013026   TPR-contain_dom       
IPR029332   PEHE_dom       

SUPFAM

SSF140931   SSF140931        + More
SSF48452   SSF48452       

Gene 3D

1.10.3290.10     1.25.40.10    

ProteinModelPortal

A0A2H1V6C4   A0A0L7LNN7   A0A2W1BIA5   A0A2A4J4N4   H9J8E9   A0A194PP13   + More
A0A0N0PBC2   A0A212EJ58   A0A0N0BJ80   A0A310SEF7   A0A2J7R3H1   A0A088A303   E9IB73   A0A2A3EA94   A0A0L7QXJ4   A0A195B6Z9   E2AZD6   A0A195CPH8   F4WG96   A0A158NI65   A0A151JX74   A0A026WTM1   A0A154P523   A0A195EGM3   E2C6W3   A0A067QSR1   A0A151WJE0   A0A182Y5M9   A0A1Q3F7G6   Q7Q1Y3   Q17A75   B0W429   A0A182PB18   A0A182RRG4   A0A1Q3F812   A0A1B6DIV6   A0A2M3Z7N7   A0A182IDX8   A0A182WHK6   A0A182UG26   A0A182LV45   A0A182K1B5   A0A182UYL7   A0A182NUZ1   A0A182XCJ8   A0A182F232   A0A2M3Z6Q4   A0A2M3Z6U7   A0A1A9XTP6   A0A1B0C7A9   A0A182Q5G9   A0A2M4BJ19   A0A2M4BJ35   A0A2M4BJ85   A0A084VDU0   A0A1B0FEY9   A0A182IQP3   A0A1A9X085   A0A1B6ESG1   A0A1A9V7F5   A0A1B6L271   A0A1A9Z5R5   A0A0L0BRZ8   E0VQJ4   A0A0K8TS66   A0A336KT82   A0A0K8UK48   A0A034VRR1   U5EIG0   A0A336MBF3   W8BKS6   B4P0E1   B3N5J3   A0A0A9WH54   B4JBN5   B4LQT7   B4KFW6   A0A3B0KD51   A0A0J9QXP8   B4I1V5   B4MUQ2   B4Q4M7   Q8SWV6   A0A0P4VN55   A0A1I8MML5   Q29JP8   B4GJC1   A0A1W4V8P6   A0A1I8NSW1   A0A1J1HT59   W5JQ21   B3MK83   A0A0P5K1N6   A0A0P4YAA9   A0A0P5GMF2   A0A165AFP9   A0A0P6BEX1   A0A0V0G742   A0A0M5IXU3   A0A0M4E0A6  

PDB

4U0Z     E-value=6.70421e-114,     Score=1051

KEGG

101737571    no KO assigned | (RefSeq) adenosine monophosphate-protein transferase FICD homolog

GO

GO:0016740   GO:0016021   GO:0005524   GO:0070733   GO:0018117   GO:0016787   GO:0051608   GO:0007632   GO:0005886   GO:0034976   GO:0042803   GO:0030544   GO:0050908   GO:0051087   GO:0044603   GO:0044602   GO:0005515   GO:0007018   GO:0008017   GO:0005216   GO:0006811   GO:0045211   GO:0006281   GO:0048384  

PANTHER

PTHR13504  

Subcellular location

Membrane  

Length:

453

Number of predicted TMHs:

1

Exp number of AAs in TMHs:

18.48164

Exp number, first 60 AAs:

18.40159

Total prob of N-in:

0.84899

POSSIBLE N-term signal

sequence

inside

1  -  32

TMhelix

33  -  55

outside

56  -  453

 

 

Pi

2.010929

Theta

6.853155

Tajima's D

-2.035326

CLR

655.388915

CSRT

0.0101994900254987

Interpretation

Possibly Positive selection