SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03090
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.228
 

Sequence

CDS
ATGTTCGGGACGTCTTCTTTAAGTGTTTTGTCGAGTTTTGATCATCAAAATCAAGATTGGAAGACATATAAGAGTAGATTGCAGCAATGGTGCATAGCTAACGGCATCGATGAGCAGTCTGATAAAGCCGGAATCAAGAGAAGAGCAGTACTCCTCAGCGCACTCACAGAGAGTACCTACCAGCTCGCAAGCAACTTAGCGTTACCCGACGATATTGCGACAAAGAGCTATGAAAGCATTTTAGGTATTTTAGATGAACACTTTATTCCAAAGCGGTGCGGATTCGCAGAGCGGTATAATTTTTACGCAGCGATGCAGCAAAATGGTGAAACTCATGGGCAATGGGCCGCACGCTTGCGAGGTTTGGCCGCACACTGCGCTTTCAAAAACCTAGAAGAATCTCTGCTAGATAAATTCGTCATGGGAATGTTGCGAGGACCCGAGCGAGAAAGGCTTTTCGCACAAGAAATCAGAGAGCTGACGTTGAGCAAAGCTGTGGAGCTGGCAGAGAGCGTGCGGTGCGCACGAGAAGGTGCAGCTGCAGCGGTAGTGCCGGAATCATCCGGTCGGGAAGGCGTTTTCAAGATTGCCCAACAAGCAAAAGGGAGCGCGGACCGAACAGCCGGCGTAAAATGCTTAGTATGTGGTTACAAAAATCACAAAACGTCAGAGTGCCGATTTTCTAAATTTAAGTGCAGAATATGTGATCGTAAAGGTCATCTCCGTAGAATGTGCCCCAGGAACAAAGTGAAGCACTTGGAGCAAGGTAACGACGATGACGAGGGCGATGACGGTGAGTTTTTGAAAAATATAAGTTGTCCAAATGGTGAGCCTTTGTACGAGACCGTGTGTTTAGAAGGTCGTAAATTTAGATGCGAAATTGACAGTGGTTCCCCTGTGTTCTGTTATATCCGAAAAGACATACAAGCGTTGGTTTTCCGGGGTTCCGTTGTCACCACCAGCGAAAAAATTATTTACGTATGA
Protein
MFGTSSLSVLSSFDHQNQDWKTYKSRLQQWCIANGIDEQSDKAGIKRRAVLLSALTESTYQLASNLALPDDIATKSYESILGILDEHFIPKRCGFAERYNFYAAMQQNGETHGQWAARLRGLAAHCAFKNLEESLLDKFVMGMLRGPERERLFAQEIRELTLSKAVELAESVRCAREGAAAAVVPESSGREGVFKIAQQAKGSADRTAGVKCLVCGYKNHKTSECRFSKFKCRICDRKGHLRRMCPRNKVKHLEQGNDDDEGDDGEFLKNISCPNGEPLYETVCLEGRKFRCEIDSGSPVFCYIRKDIQALVFRGSVVTTSEKIIYV

Summary

Similarity
Belongs to the complex I LYR family.
EMBL
AB126055    BAD86655.1    ODYU01013266    SOQ59972.1    NWSH01000444    PCG76387.1    + More
KZ149914    PZC78019.1    JTDY01007576    KOB65104.1    JTDY01013871    KOB52076.1    JTDY01011156    KOB57463.1    GBHO01013125    JAG30479.1    GDHC01002084    JAQ16545.1    GEZM01085308    JAV60010.1    GDHC01002706    JAQ15923.1    ABLF02030456    ABLF02003031    ABLF02009153    ABLF02009156    ABLF02036842    ABLF02042564    ABLF02052474    ABLF02006499    ABLF02041879    GEZM01092768    GEZM01092767    JAV56467.1    GDHC01014794    JAQ03835.1    ABLF02027007    ABLF02027010    ABLF02035806    GEZM01081409    JAV61645.1    ABLF02030002    ABLF02036937    ABLF02026287    ABLF02026295    ABLF02051114    ABLF02002867    ABLF02002868    ABLF02021819    ABLF02042177    ABLF02055259    ABLF02058160    AGCU01195578    KK857512    PTY27246.1    ABLF02001462    ABLF02041863    ABLF02066900    ABLF02066901    ABLF02026830    ABLF02012266    ABLF02012271    KK857520    PTY27255.1    EF199621    ABM90392.1    LSMT01000299    PFX20902.1    KK854477    PTY16206.1    EF199622    ABM90393.1    LSMT01000298    PFX20931.1    GBHO01031997    JAG11607.1    GEZM01036245    JAV82862.1    JYDK01000935    KRX51560.1    ABLF02038551    ABLF02038554    ABLF02042419    JYDK01000986    KRX51372.1    KK855004    PTY20231.1    AZHX01001899    ETW98899.1    JYDN01000181    KRX54109.1    JWZT01003307    KII67125.1    JYDH01000010    KRY40903.1    JYDN01000036    KRX62850.1    GEZM01096178    JAV55085.1    GEZM01061347    JAV70540.1    GGMR01017626    MBY30245.1    GEZM01096180    JAV55080.1    LSMT01001234    PFX12679.1    ABLF02030730    ABLF02030738    JYDW01000348    KRZ48953.1    GEZM01005739    JAV95951.1    GGMR01001051    MBY13670.1    GEZM01005740    JAV95950.1    GACK01000385    JAA64649.1    GCES01042893    JAR43430.1    GEDC01013717    JAS23581.1    JXUM01013128    KQ560369    KXJ82759.1    AJWK01009946    KRX54093.1    GEDC01021971    JAS15327.1    HADZ01011823    HAEA01016148    SBP75764.1    ABLF02038615    ABLF02064938    JYDI01000102    KRY52595.1    GEZM01009753    JAV94337.1    GEZM01050895    JAV75318.1    GBBM01006246    JAC29172.1    ABLF02018110    ABLF02065955    JTDY01002326    KOB71659.1    GEZM01014356    JAV92134.1    KRX62729.1    KRX62859.1    JYDM01000372    KRZ82101.1    JYDO01000016    KRZ77842.1    HAEB01010230    SBQ56757.1   
Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF17917   RT_RNaseH
PF00098   zf-CCHC
PF05347   Complex1_LYR
PF03732   Retrotrans_gag
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR034128   K02A2.6-like       
IPR000477   RT_dom       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR032710   NTF2-like_dom_sf       
IPR018222   Nuclear_transport_factor_2_euk       
IPR041373   RT_RNaseH       
IPR008777   Phytoreo_Pns       
IPR008011   Complex1_LYR       
IPR005162   Retrotrans_gag_dom       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF54427   SSF54427       
Gene 3D

Ontologies

Topology

Length:
327
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0006
Exp number, first 60 AAs:
0.00024
Total prob of N-in:
0.00291
outside
1  -  327
 
 

Population Genetic Test Statistics

Pi
6.780998
Theta
18.555303
Tajima's D
-1.381594
CLR
26.633334
CSRT
0.0734963251837408
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号