SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03073
Annotation
putative_RNA-directed_DNA_polymerase_from_transposon_BS_[Papilio_machaon]
Location in the cell
PlasmaMembrane   Reliability : 1.747
 

Sequence

CDS
ATGAAAAGTGAGAAAAAGGCTTATTTTAATTTTAACATTAACAATAAGATTCATAATCCCTCTATCCTATGGAAAAATTTGAAAACAAATATTTTACCTCCTGTAGATCATGAACTACCATTAATTTTTAACGATGCTAAACAAATTAATGATCATTTTTTGAAAATTCCTAATGTAATCAATTGTTCTTCTATTATATCCAATACTAATTATTTTAACTCTCATCGTTACTCTGATACACAATTTAATCTGTCTGGGGTAAAGGAATGTACTGTGTTGCAGATCTTGCAACAACTGAAGTCGGATGCTCTGGGTGTTGATGATATTTCCCTAAAAATGTTGTGTATGACATTGCCCTACAGTCTTACTTCTGTCACCAATCTTGTTAATATGTCAATTAATACATCGATATTTCCGTACACTTGGAAGACTGCTGTGGTTCGTCCTGTTCCTAAGAAACCTAATGCCATGACACTCAGTGACCTTCGACCCATCAGTATATTGCCCTGCTTGTCTAAAATTCTAGAGAAAGTAGTATCTTCACAGCTGACGGACTATCTCGAGAAACATAACATATTGCCTGAGTATCAGTCCGGATTCCGGAGATCGCGTGGTACTGCAACTGCTCTCTTAGATGTGACGGATAGTATCCTTGCTGCACAGGATCGGGGTATGTGTACGGTTCTGGTACTTCTGGACTTCTCTCGAGCATTCGACAGCTTGAACATTGACCTTCTTCTTGCCAAATTGAGTTTCTACGGCTTAAGTGCGGATACCATTCGTTGGTTCTCAAGTTATCTGACTGAACGATCGCAATTGGTGGAAATTCGTCGCGGTGAGGGTAATGTTCGATCCAACATGGCTAACGTCATTAATGGTGTACCACAGGGTTCGATCCTGGGCCCTTTGCTATTTATCCTTTACAGCGCAGATATTGTTGGTCATATCAATCATTGTCAGTACCATATATATGCTGATGACATTCAACTGTACATCTCTTTTAAGATGTCTGAGTTTACAATGGCCATTGAGAAACTTACAGGGGACCTAAATAGAGTGGCGAATTGGTCGGAACAGAACTCACTCTTCTTAAATCCCAGCAAGACTAAATATATTGTGTTTGGAAATGAATCTCGATTGTCTAAGCTTCCATCACAACCTTTCAATGGGTTAAATATTCGAAATGACCCCATTGAGAGAGTATATGAGGTGCGTAACTTGGGCCTGCTGATGGACGCAGAGAGTACAGAATGCATGCATGAGATTTTGCTTTAG
Protein
MKSEKKAYFNFNINNKIHNPSILWKNLKTNILPPVDHELPLIFNDAKQINDHFLKIPNVINCSSIISNTNYFNSHRYSDTQFNLSGVKECTVLQILQQLKSDALGVDDISLKMLCMTLPYSLTSVTNLVNMSINTSIFPYTWKTAVVRPVPKKPNAMTLSDLRPISILPCLSKILEKVVSSQLTDYLEKHNILPEYQSGFRRSRGTATALLDVTDSILAAQDRGMCTVLVLLDFSRAFDSLNIDLLLAKLSFYGLSADTIRWFSSYLTERSQLVEIRRGEGNVRSNMANVINGVPQGSILGPLLFILYSADIVGHINHCQYHIYADDIQLYISFKMSEFTMAIEKLTGDLNRVANWSEQNSLFLNPSKTKYIVFGNESRLSKLPSQPFNGLNIRNDPIERVYEVRNLGLLMDAESTECMHEILL

Summary

EMBL
KQ461198    KPJ06072.1    NWSH01000010    PCG80923.1    NWSH01000998    PCG73165.1    + More
KZ150070    PZC74075.1    NWSH01006271    PCG63543.1    NWSH01001817    PCG70032.1    NWSH01000133    PCG79211.1    GEZM01045590    GEZM01045589    JAV77734.1    GEZM01051381    GEZM01051380    JAV74995.1    DNUT01000258    HBI40281.1    GEBQ01027915    JAT12062.1    GEZM01007604    JAV95063.1    GEBQ01020572    JAT19405.1    DNUT01000248    HBI40237.1    DMQF01000352    HAO15199.1    DNUT01000056    HBI39512.1    GEZM01074146    JAV64657.1    DNUT01000451    HBI40968.1    GEZM01039829    JAV81150.1    DMQF01000113    HAO14334.1    GEZM01000581    JAV98361.1    DMQF01000396    HAO15350.1    DMQF01000003    HAO13943.1    GEBQ01025517    JAT14460.1    DMQF01000361    HAO15230.1    GEBQ01015097    JAT24880.1    GEBQ01013060    GEBQ01010336    JAT26917.1    JAT29641.1    GECU01021424    JAS86282.1    DNUT01000374    HBI40695.1    GEBQ01005183    JAT34794.1    GECZ01031781    JAS37988.1    GEZM01074041    JAV64693.1    GEZM01074147    JAV64656.1    DMQF01000030    HAO14052.1    GEZM01034710    JAV83652.1    GEZM01008907    JAV94684.1    GEZM01044382    JAV78261.1    LBMM01010997    KMQ87090.1    GEZM01041318    GEZM01041317    JAV80524.1    GEZM01037808    JAV81920.1    GEBQ01006447    JAT33530.1    GANO01004338    JAB55533.1    DMQF01000478    HAO15711.1    DNUT01000030    HBI39446.1    DNUT01000170    HBI39961.1    DMQF01000446    HAO15584.1    GANO01003893    JAB55978.1    GANO01004238    JAB55633.1    DMQF01000436    HAO15547.1    GANO01004070    JAB55801.1    GBBI01004799    JAC13913.1    DMQF01000157    HAO14486.1    GEZM01027174    GEZM01027173    JAV86813.1    MRZV01001256    PIK39278.1    GEZM01076243    JAV63794.1    DNUT01000297    HBI40414.1    GANO01004066    JAB55805.1    DNUT01000507    HBI41157.1    GANO01004166    JAB55705.1    GAMC01021038    GAMC01021033    GAMC01021031    JAB85522.1    GAMC01021037    GAMC01021036    JAB85519.1    GANO01003995    JAB55876.1    GANO01004258    JAB55613.1    GANO01004126    JAB55745.1    LBMM01004152    KMQ92759.1    GANO01004094    JAB55777.1    GALX01002227    JAB66239.1    LSMT01000642    PFX15509.1    GFDF01007660    JAV06424.1    LSMT01000554    PFX16333.1    LBMM01017805    KMQ83966.1    GANO01004069    JAB55802.1    GALA01001237    JAA93615.1    GANO01004198    JAB55673.1    MRZV01000088    PIK59242.1    GBHO01012041    GBHO01012038    JAG31563.1    JAG31566.1    GEZM01061182    JAV70705.1    GEZM01061184    JAV70703.1    GANO01004275    JAB55596.1    GEZM01061185    JAV70702.1    LSMT01000499    PFX17076.1    GEZM01061183    JAV70704.1    DNYW01000360    HBK72410.1    NWSH01000817    PCG74070.1    LBMM01003452    KMQ93522.1    GANO01004325    JAB55546.1    GCES01121257    JAQ65065.1    MRZV01001115    PIK40493.1    LBMM01009184    KMQ88324.1    GANO01001936    JAB57935.1    GBHO01019121    JAG24483.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF12662   cEGF
PF07645   EGF_CA
PF00041   fn3
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR011011   Znf_FYVE_PHD       
IPR009030   Growth_fac_rcpt_cys_sf       
IPR026823   cEGF       
IPR001881   EGF-like_Ca-bd_dom       
IPR006585   FTP1       
IPR000152   EGF-type_Asp/Asn_hydroxyl_site       
IPR008979   Galactose-bd-like_sf       
IPR018097   EGF_Ca-bd_CS       
IPR013032   EGF-like_CS       
IPR000742   EGF-like_dom       
IPR036179   Ig-like_dom_sf       
IPR013783   Ig-like_fold       
IPR003961   FN3_dom       
IPR036116   FN3_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57903   SSF57903       
SSF57184   SSF57184       
SSF49785   SSF49785       
SSF49265   SSF49265       
SSF48726   SSF48726       
Gene 3D
PDB
6AR3     E-value=0.0124771,     Score=91

Ontologies

Topology

Length:
424
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.8145
Exp number, first 60 AAs:
0.0025
Total prob of N-in:
0.04401
outside
1  -  424
 
 

Population Genetic Test Statistics

Pi
496.825557
Theta
225.925675
Tajima's D
3.520605
CLR
0.017705
CSRT
0.994100294985251
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号