SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03059
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.352
 

Sequence

CDS
ATGAAAGAAGATTGTGATAGTGTCAGTGACAGTGATTTTGTCGGGTTCCTCCGGGAAAGGTACCCGACAATTAGGGCCGAATATCAGGCATATAGGGCCTCTCGTGGCAATCCCTCCCCCCCCGCGTCCGTCGCCGCGTATTTCAAACGTGCCTCGGAGGCACGCCGCGCGCCCCCCGCCGCCGCGTTAAGTTCGAGCGCACGTTCCGACGATGCGGCTCACATAGCGCCTAACGCAACCCCCACCCCCGCGCCCGCGTCGTTTACGTCATCGCGCGCTTCGTCCGTCGCGACCTCGATCGTTTCGAGTTCAGGCTCCGATACCGAATCGGAGATGGATTTCGAATCCGCGTCAAGCCCTCAGCCTGGAACCTCGGATGGGTTCCAAACCGTAACGCGCGGTAAAAAGCGTTCTCGCGCCGTGGAGTCCCGGAGCTCCACGACGAAGCAAACTAAATCCGCGACCGCCTCCCGCCCGCAGGTAGTCGTGACACCGGAGTCGGACTCCGCTCGCCGCGTAACCCCGCCGCCGCGTCCCAAGCCCGCGCCCGCTCCTAAAGTAGCTGCCCCACCCCCGCTGATACTTCAAGAGAAGACAGCGTGGAATCGCGTGTCTCAGGCCCTTCAGGCCAACAAAATTAATTACACCCATGCGCGTAACGTCGCGCATGGGATTCAGATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCTTCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTGATACGCGGAGTCCCTAAGGAGTTAGACATCGATTACATAAAGGAGGATCTGACCGCTCAGTCCCTCCCGTTAGTTAGCGTGCACCGGATGCACAGTGGGCGGGGCAAGCAGCCCTACAACATGATCCTGGTAGCTCTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCGATCGAAGCTCCCCATAAGCGTGGCACTCCCGGGCAGTGCTACAGGTGCCAACTCTATGGCCACTCGGCGCGTAATTGCCACGTGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCTACGATAGATTGCGTTAGAGATAGGGAAACTGCGACCGAACCTCCCAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCCAGGGCTCCGCGAAAACGCCCAACCCACCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCTTCAGTGCCGAAACCCGCCTTCGTGCCGGCTGCAGTTCCCACGGTCTCGGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACGGAAACCGCACCCCCGCCCCCGCTCGTGACACGCCCCGCGCCCCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGTCAACGACTTCGCGCTCGTGCGTGACTTCGTCACTGCGGTGAACTTCGACCGTCTGCGATCGTTCGCAGACGCGATACGTAGGTCGGTAACCCCCGAACAGCGGCTCGCGGCCGCATTCGATCACATGGACGTCTACGAGTCCGTGTCGCCATTCTATAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTTGAATTCCTCCGCGATAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTTCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGATTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCCTTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGAGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAACAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACTACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCATAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGAACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAACCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGCAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACTCAGCCCGCACCCACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTTAGGAATGTGGATCTCCACGATGACCTGGAGCTCGACTCTCTTAGTAAGTATCTACAGTCGGCATCACTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTAAACCGTCGACGTCGCCCAAAGCACGTCATTACGGATCCTCCTGATCCATTAACGGTGCTTTTAGGCACCACAAGCACCGGTCACCGTCCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGCGAACTAA
Protein
MKEDCDSVSDSDFVGFLRERYPTIRAEYQAYRASRGNPSPPASVAAYFKRASEARRAPPAAALSSSARSDDAAHIAPNATPTPAPASFTSSRASSVATSIVSSSGSDTESEMDFESASSPQPGTSDGFQTVTRGKKRSRAVESRSSTTKQTKSATASRPQVVVTPESDSARRVTPPPRPKPAPAPKVAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSSYLRKENIGFHTYALQEDRELRVVIRGVPKELDIDYIKEDLTAQSLPLVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHVRPRCVKCLGDHATIDCVRDRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTETAPPPPLVTRPAPQPLLAPRPAPAFRPPQPSAVNDFALVRDFVTAVNFDRLRSFADAIRRSVTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTSTCYPYNIALRPSTIDLALIRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPYGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTPSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLEPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEANVIGIHKPGKPTNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQTPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHSARTHLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSLSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVNRRRRPKHVITDPPDPLTVLLGTTSTGHRPRRTRRLRRRARRAN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000601302,     Score=108

Ontologies

Topology

Length:
1485
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.528869999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1485
 
 

Population Genetic Test Statistics

Pi
104.854075
Theta
1.617747
Tajima's D
0
CLR
114.074527
CSRT
0.419979001049948
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号