SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03036
Annotation
PREDICTED:_craniofacial_development_protein_2-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.447
 

Sequence

CDS
ATGAAACAACGGACAACGATTGGTAGCTGGAATGTGAGAACCTTGAAAGAAGAAAGCCGCCTACAGCAGTTAACAAAAGTTATGCGCAGCTACAAACTTGAGATTCTTGGCATTTCAGAAACTAGATGGAAGGGTTTTGGAGAACACCAAGAAGATGATATGACTTTCATTTATTCAGGCAAAGATATCACTGATAACCATGAATCAGGCGTAGGTATTTTAATGACCACCAAAGCTAAGAGCAGTCTGCTCGACTGGCATCCTGTTTCGGACCGAATAATAATGGCGCGTTTTTACTCAAGAGTGCGGAACATCTCAGTCATACAATGCTATGCGCCTACAAATGCAGCGAGTACAGCCACAAAAGCAAAGTTCTACAGTCACTTGCAATCGACTCTGCAGAAGATAAAGCGCCAAGATATTGTTATTTGCATGGGAGACTTCAACGCCCAACTGGGATCAGACAACACGAACATTGAGCCTTGGCTAGGCAGACACGCGATGGGACGGAGATCTGAAAACGGTGATATGCTCATAGATCTCTGCTGTCAAAATGACCTCATAGTGGGGGGATCTATTTTCCCTCATAAGAGTTGTCACAAAGTTACATGGGTTTCACCTGACCGTATCACAGAGAACCAGATCGATCATGTGTTGATAAGCCGCAAGTGGAGAAGATCCCTTCTAGACGTTCGCAATAAAAGGGGTGCGGACATAAACAGCGACCACCACCTGGTTGTGGCAAAGATAAAACTAAAAGTAGCGAAAATCCAGCGGACTGCCAAAACAGCAAGTAGGAACTTTGATACAGAGAAGCTTCGGAATCCAGCCACAAAACAAAATTTCCAAGACGACCTCCGTAATCGTACTGTTAACATTAGCTATGAAGAAGGGACTATCGAAGATCATTGGGAGTCTGTTAGAGGCGCATTCCGTGAAAGCTGCCAGTCTGTGCTTGGTTACAAATGCACGCCTAAAAAGAAATGGATCTCAGGAACCACTTGGGACATGATCCAGGCAAGGCAGCAAAAGAAAGAGCAGATCAACTCTGCACAAACTCTGGAAGCCAAAGAAGAACTAGCTTATGAGTACTACATTTGTGAGTCAAAGATCAAACTCAACCTAAAGAAAGACAAACGTGCTTGGACCGAAGCTATAGCACAGAAAGCAGAGCTGGCGGCATATTCTGGAAACATGCCAGAGTTACATAAATCAGCAAAAATTCTCTGCAATAAACCAATCGCTGATAAGCCACTGAGGGATGACGCCGGAAATCTACTAGTTACCTTAGAGCAACAACTGGTTGGATGGCGTGAGCACTTTGCTAAGGTCTTCGAAGCTCGGCCCACGGTGACTATCGTTGGACACGAGCCTTCTCAGAAACTACTCGATATTGAAGTGGGCCCCCCAGTCGTAACCGAGATTAAAAAGGCAATCACATCTCTAAAATCTGGCAAGGCTCCCGGTGGCGATGGCATTACGGCTGAAGTACTGAAGGCGGATGTTAATCTCACTACCCAGATTCTACACCCGCTACTATCACGTATTTGGGAGCAGGAATACATACCAGCATCGTGGAAGGAAAGCGTTATCGTGAAACTACCAAAAAAGGGTGACCTTTCCTCGTGTGGCAACTGGAGGGGTATAAGCCTGCTACCAATATGTTCAAAAGTTCTCGCGAAAATTTTGCTGATGAGGATGGCCAAAGTGGTTGACAGTGAGCTCAGAGAAGAACAGGCAGGGTTTAGGCCAGGACGTTCATGCTCGGACCAAATAAACCTTTTACGAATGATCCTAGAACAATGTCAGGAGATGCAGTGTGAAGTTTTCACATTGTTTATCGACTTCGAAAAGGCCTTTGACAGTGTCAGTTGGTCCAGCATTTGGACTGTTTTGAAGAAAAAAGGCGTGCCCGACAAGCTCATAAATGTCATAAAAGCGCTTTACTATGGATCGTCGTGTAGAGTGCTCCATAGGGGAAAACTCACGGATAATATCGTGGTCACCGCAGGCGTCAAGCAAGGTTGCTTGCTGTCTCCCCTGCTGTTTATAATGGTGCTTGATGATGTGATGCGCAGAGTCACCTGTAAATGCCGACAAGGACTACCTTGGACCGCGGATGAAGACCTTGAGGACATCGACTTTGCTGATGACATTTGCCTCCTAGCAACCAATCGGCAGCAGCTACAAAACAAAGCAGATGATCTAGTAGATGAAGCTGAAAAAGCAGGGCTGCGTATTAATTTCTCAAAAACAAAAGAAATGCGCATAAATACCACCGATTCGGCTCCTATGTCGATCAAAGGGAGGCACATCGAGCAGGTGGGAAGCTTCTGTTACCTGGGCAGCATTGTGGACGATAGGGGAGGCACCGAGGCAGACATTGCGGCTCCTTGTATACCTTTTGGCACATTTATGTCCAGTATAATTATGACTTTTGCACCGTTTTTCAAAAAGTTATCAGCTATAGCATAA
Protein
MKQRTTIGSWNVRTLKEESRLQQLTKVMRSYKLEILGISETRWKGFGEHQEDDMTFIYSGKDITDNHESGVGILMTTKAKSSLLDWHPVSDRIIMARFYSRVRNISVIQCYAPTNAASTATKAKFYSHLQSTLQKIKRQDIVICMGDFNAQLGSDNTNIEPWLGRHAMGRRSENGDMLIDLCCQNDLIVGGSIFPHKSCHKVTWVSPDRITENQIDHVLISRKWRRSLLDVRNKRGADINSDHHLVVAKIKLKVAKIQRTAKTASRNFDTEKLRNPATKQNFQDDLRNRTVNISYEEGTIEDHWESVRGAFRESCQSVLGYKCTPKKKWISGTTWDMIQARQQKKEQINSAQTLEAKEELAYEYYICESKIKLNLKKDKRAWTEAIAQKAELAAYSGNMPELHKSAKILCNKPIADKPLRDDAGNLLVTLEQQLVGWREHFAKVFEARPTVTIVGHEPSQKLLDIEVGPPVVTEIKKAITSLKSGKAPGGDGITAEVLKADVNLTTQILHPLLSRIWEQEYIPASWKESVIVKLPKKGDLSSCGNWRGISLLPICSKVLAKILLMRMAKVVDSELREEQAGFRPGRSCSDQINLLRMILEQCQEMQCEVFTLFIDFEKAFDSVSWSSIWTVLKKKGVPDKLINVIKALYYGSSCRVLHRGKLTDNIVVTAGVKQGCLLSPLLFIMVLDDVMRRVTCKCRQGLPWTADEDLEDIDFADDICLLATNRQQLQNKADDLVDEAEKAGLRINFSKTKEMRINTTDSAPMSIKGRHIEQVGSFCYLGSIVDDRGGTEADIAAPCIPFGTFMSSIIMTFAPFFKKLSAIA

Summary

EMBL
FJ265558    ADI61826.1    GDHC01000226    JAQ18403.1    BN000794    CAJ00236.1    + More
AJWK01034673    LSMT01001244    PFX12648.1    LSMT01000478    PFX17357.1    UFQT01001780    SSX31783.1    FN356221    CAX83710.1    UZAI01017328    VDP23394.1    AAGJ04045270    ADMH02001629    ETN61698.1    AFYH01088828    PZQS01000003    PVD33720.1    PZQS01000004    PVD32651.1    UZAK01036860    VDP56899.1    PDHN01000949    PGH37547.1    MRZV01000018    PIK62110.1    AY027869    AAK14815.1    PYGN01000203    PSN51319.1    AF412214    AAM93546.1    JARK01001341    EYC29874.1    PYGN01000324    PSN48495.1    PYGN01000020    PSN57453.1    HE799691    CCH14900.1    PYGN01000070    PSN55417.1    LBMM01005351    KMQ91586.1    JARK01001422    EYC04705.1    PYGN01001004    PSN38555.1    PYGN01000219    PSN50892.1    FJ265547    ADI61815.1    AJVK01001578    GBBI01004261    JAC14451.1    KZ150025    PZC74827.1    ABLF02042851    AJWK01020943    GECL01002632    JAP03492.1    FN356222    CAX83711.1    GGMR01020071    MBY32690.1    FJ265555    ADI61823.1    GDHC01021627    JAP97001.1    ABLF02018097    ABLF02043469    ABLF02056908    CABG01000179    CCD61084.1    AFYH01196306    GECL01001585    JAP04539.1    FJ265546    ADI61814.1    PYGN01000465    PSN45867.1    ABLF02017638    ABLF02041349    GBBM01003639    JAC31779.1    KU311054    ALX81665.1    ABLF02066124    GBRD01011073    JAG54751.1    FJ265553    ADI61821.1    PYGN01003402    PSN29545.1    PYGN01000129    PSN53384.1    GGMS01009011    MBY78214.1    HACG01049402    HACG01049403    HACG01049405    HACG01049409    CEK96267.1    CEK96268.1    CEK96270.1    CEK96274.1    FJ265557    ADI61825.1    KF881087    AIJ27486.1    FJ265560    ADI61828.1    FJ265548    ADI61816.1    GAPW01000107    JAC13491.1    GU815089    ADF18552.1    GAPW01000151    JAC13447.1    FJ265552    ADI61820.1    ABLF02019047    ABLF02019049   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF01553   Acyltransferase
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR027124   Swc5/CFDP2       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR002138   Pept_C14_p10       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=4.55541e-08,     Score=141

Ontologies

Topology

Length:
824
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.8478
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00301
outside
1  -  824
 
 

Population Genetic Test Statistics

Pi
430.208082
Theta
197.891633
Tajima's D
3.733475
CLR
13.270848
CSRT
0.997200139993
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号