SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03031
Annotation
PREDICTED:_uncharacterized_protein_LOC107445205_[Parasteatoda_tepidariorum]
Location in the cell
Nuclear   Reliability : 4.008
 

Sequence

CDS
ATGGTATATAAATACAAGAGGAAGACTAATCAAGCCCAATGGAGTGAGGACAGTATGATGCTTGCAATAGCAGATTGCAATTCTGGCATTCCTGTCAAAACGACCGCAAAAAAGTATGGTCTACCTTACGCCACTCTCTATAGGCATTGGAAAAAAGGTAGTTCGACGGCTCAGCTTGGTCGTTTTCGTAAAGTTTTCAACGATGGTCAAGAGGGAGATCTTCGAACGTATTTGTATGAAATGGATAGTGTTTTTTATGGGCTAACCCGAGAAGATTTTAAAACATTAGTTTTTGAATACGCGAAACGCAATAATGTCACTTATCCGCCTAGTTGGGACAAAAATAAAAAAGCTGGTGATGATTGGCTAGCAGGATTTATTAGAAGAAATCCACAAATTACACTAAGAATTCCAGAAGCAACCACAATTGGCAGAGTTAAAGGTTTCAGTCGTCCTCAAGTAGAAAGGTTCTATCTATGTCAAATTGATGGTACTAGAATCTATAATATAGATGAAACTGGCATTCAGACCTCGACAAATAAACCACCCAAGGTTCTTTCAGTTAAAGCTTTACAGTACGCAACTGAAAATAATGTCATCATTTTGTCTTTGCCACCGCACACCTCAAACAAACTTCAACCTCTGGACGTGGCTGTGTATGGTCCATTTAAAATATTCTTCGAGCAAGAAATCAATAGATTTCAAAAGGCTCATCCAGGTAGGATAATCAACCAATACGATGTAGCCAAACTGTTCAGTCCAGCTTATCTGAAATCTGCTACTCCTAACAATGCTATCAAAGGCTTTCAATCAACCGGTATCTGGCCAACAAATAAAGATATATGGGGAGAAGAAGATTATGTACCATCTTCTATTACAATGACAGACCGTAATACCGCTAACCAACTGGAGACTTTTATAGACTCAAACAGTCAAAATGTTGAAATTACGATTGACATCGAAAAGCCTTCTACATCAGGGCTCCAAAGTCAGTCACTGCAAATTGATGTAGAACCACTGGAACAGATTGAAAGAAAATTTATTGAGAATGTGAATGTAGAAGTTGAAGCTGCAGTGGAAAATAGTATCATGGGTATAGTATCAGTGTCCAATATGAATCAAATACATTCTCGAGATACATCGCCTTCAATTTTGGATAAATTACCCGACAAAGATCCCCTTACATGCAATGCTGTTGTAGTAACGGCTGTAGCTGATAATACTCAAAAATTGTCTAAACCACAAGAAGCAATGTCCACTGAAGATATGAATCAAGGTGCAGATCTGACTCAAGACAGTATAGATATAAAAGAGGGTCAATTTAAAGGCAACGATGATGAAATTATTATGGACCTGGAATCATCTACGGCTCGGGCTTCAGCATATTTCAGTCCTAAAGACATAAGACCGCTTCCGATGCCACGCGTTTCTGTGGGTACACGTAAAAGAAAGGTTCAAAAGTCTGAGGTGTTAACAAGCACGCCAGTGAAGCGAAAACAAAAAGAAAAATTTATAAAAATTAATGTCAAAGCAATGAAAAATATGAATATAGATTTAAATGCTAAGCCAAAGACTGCGACAAAGAAAAATACTAAAACGACCAAAAATATAATTGTTAAAGATAAAAGTAGTGATAAGGAAAACGAGGAAGAACAGTGTGTATGCTATTATTGTGGGGAGAACTATATAGAAATAAATAAAAAACCAGTTGAGGATTGGATTCAGTGTGATAAATGTAAGCAACGGAGTCACGAAAAATGCACGGCTTATGGAGGAATAGGCTTATTCTTTTGTGATATTTGCACGGATTAG
Protein
MVYKYKRKTNQAQWSEDSMMLAIADCNSGIPVKTTAKKYGLPYATLYRHWKKGSSTAQLGRFRKVFNDGQEGDLRTYLYEMDSVFYGLTREDFKTLVFEYAKRNNVTYPPSWDKNKKAGDDWLAGFIRRNPQITLRIPEATTIGRVKGFSRPQVERFYLCQIDGTRIYNIDETGIQTSTNKPPKVLSVKALQYATENNVIILSLPPHTSNKLQPLDVAVYGPFKIFFEQEINRFQKAHPGRIINQYDVAKLFSPAYLKSATPNNAIKGFQSTGIWPTNKDIWGEEDYVPSSITMTDRNTANQLETFIDSNSQNVEITIDIEKPSTSGLQSQSLQIDVEPLEQIERKFIENVNVEVEAAVENSIMGIVSVSNMNQIHSRDTSPSILDKLPDKDPLTCNAVVVTAVADNTQKLSKPQEAMSTEDMNQGADLTQDSIDIKEGQFKGNDDEIIMDLESSTARASAYFSPKDIRPLPMPRVSVGTRKRKVQKSEVLTSTPVKRKQKEKFIKINVKAMKNMNIDLNAKPKTATKKNTKTTKNIIVKDKSSDKENEEEQCVCYYCGENYIEINKKPVEDWIQCDKCKQRSHEKCTAYGGIGLFFCDICTD

Summary

Pfam
PF03184   DDE_1
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR019786   Zinc_finger_PHD-type_CS       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
SUPFAM
SSF57903   SSF57903       
Gene 3D

Ontologies

Topology

Length:
603
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00419999999999999
Exp number, first 60 AAs:
0.00241
Total prob of N-in:
0.01246
outside
1  -  603
 
 

Population Genetic Test Statistics

Pi
463.568802
Theta
203.939837
Tajima's D
4.054084
CLR
0
CSRT
0.999150042497875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号