SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03026
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X3_[Bombyx_mori]
Full name
PiggyBac transposable element-derived protein 4      
Location in the cell
Nuclear   Reliability : 1.768 PlasmaMembrane   Reliability : 1.471
 

Sequence

CDS
ATGAACGTGTACCTTTTCCTTTCAGGCAGCGAAGAAGAGTCTGACGAAGAGGAAGAAGGGATTGCCGAGTTAGCGGTGCCCCGAATAGCAAGAATGTTTATGGACGAAGACGATGCGGAAGTCAACGAAAGATCCGCCAACGCTACTTTGGAGCGGTCCCCTCAATCGCCTCGACCAGCCGATTGTGCTTCAACGCCCGCCTCACCGACGCCTGTTTCGCCGACTGCCATGGAACCCAGCAACAAATTTCAATTTGAATGGAGAAAGTTTTCAACGCCTCAAATTGAACCTCATTTGAGGCGAGAACCGTTCTCGCAAATTAGTGGCCCTACAGTTTCTTTCACGAGACCATACGAAGCATTTATTGCTATATGGGATCGTGAAATTATGGAAATGATTGTCAGGGAAACTAACATTTACGCACAGCAGCTGGCAACGACCATGTTGGAGAATGGAACGATCTGTCCTAGTAGTCGAATTACTCGTTGGCATGATACAAATGTAAATGAACTTTACACGTATTTTGCCATCGTTCTGGCTATGGGAGTGGTGATCAAAACCCGGTTAACCGAATACTGGAATACCTCTAACGACATCTTCAGTACTCCTGGCTTTTCCACGGAGATGTCATATGACAGATTCCACCTCCTGTCAGCATGTCTGCATTTTAATAATAATAAAGATTGTAACTCTGCGTTGTTGACACGACCCCAAGCTAAACTTTTTAAAATTAAACCTATAATAGATCACCTTAATCGCAAGTTTTCTGAATTATATAGTTTGTCTCAAAATGTGGCTCTCGATGAGAGTCTGACCATGTGGAAGGGCTGGCTTGAAATAAACCAGTTCATCCCTAACAAAGCAGCCACAGTTGGAATCAAAACCTTTGAATTGTGTGAATCTCAGACTGGTTATTTGTGGCGTTTTGAAGTATATGCAGGCCATGACACCTCGGCATTTCAAGAAGATGATCCAGTCTCGGGGAAAGTACCAGCTCTAGTGCTCAGACTTTTAAATGGTCTTGAACATAAAGGGCACACAATATGGATGGACAATTACTACAACTCTCCATCACTGGCACGAGAACTGAAGATCCGGGGATTTGACTGCGCGGGGACGCTCCGGACAAACCGTCAATTCGTACCACCTGAATTGGCGAGTATTACAAAAAACGACATGATTGTCGGTCAATTGTTGGGATGCACCTCTGGAGATGTGGACATTGTGGTGTGGAGGGATAAAAACCTCGTGGCTTTTATTTCAACATACCATGCTCTCCTAGCTACCAAGTGTGGCGATACAGTTAAGCCGACAGTCGCGCAGGACTATAATCTTAATATGGGCGGAGTAGACCGTAAGGATCAGCAACTCGCAATGTACCCTTTAGAAAGAAAAAGGAATAAGGTGTGCGATGCTTATAAACATGATTAA
Protein
MNVYLFLSGSEEESDEEEEGIAELAVPRIARMFMDEDDAEVNERSANATLERSPQSPRPADCASTPASPTPVSPTAMEPSNKFQFEWRKFSTPQIEPHLRREPFSQISGPTVSFTRPYEAFIAIWDREIMEMIVRETNIYAQQLATTMLENGTICPSSRITRWHDTNVNELYTYFAIVLAMGVVIKTRLTEYWNTSNDIFSTPGFSTEMSYDRFHLLSACLHFNNNKDCNSALLTRPQAKLFKIKPIIDHLNRKFSELYSLSQNVALDESLTMWKGWLEINQFIPNKAATVGIKTFELCESQTGYLWRFEVYAGHDTSAFQEDDPVSGKVPALVLRLLNGLEHKGHTIWMDNYYNSPSLARELKIRGFDCAGTLRTNRQFVPPELASITKNDMIVGQLLGCTSGDVDIVVWRDKNLVAFISTYHALLATKCGDTVKPTVAQDYNLNMGGVDRKDQQLAMYPLERKRNKVCDAYKHD

Summary

Keywords
Complete proteome   Reference proteome  
Feature
chain  PiggyBac transposable element-derived protein 4
EMBL
KQ459989    KPJ18766.1    ODYU01000749    SOQ36006.1    KZ150113    PZC73302.1    + More
NWSH01005160    PCG64390.1    NWSH01000726    PCG74565.1    NWSH01005605    PCG64100.1    NWSH01008683    PCG62453.1    JTDY01002247    KOB71806.1    KZ150197    PZC72319.1    NEVH01026090    PNF14815.1    NWSH01000091    PCG79681.1    NEVH01017475    NEVH01002684    NEVH01001351    PNF24176.1    PNF41738.1    PNF42927.1    NEVH01026393    PNF14286.1    NEVH01009069    PNF34004.1    NEVH01026401    NEVH01025126    NEVH01020854    NEVH01013255    NEVH01000629    PNF14193.1    PNF16176.1    PNF21085.1    PNF29260.1    PNF43158.1    NEVH01021985    PNF18924.1    NEVH01011876    PNF31583.1    PZC73303.1    NEVH01026109    PNF14626.1    NEVH01016950    PNF24933.1    GEGO01007089    JAR88315.1    JU326601    AFE70357.1    CM001259    EHH27175.1    CM001282    EHH62949.1    AK057200    AK094816    AK289491    AC079203    CABD030095328    AQIA01062119    ABGA01233763    NDHI03003689    PNJ08370.1    AQIB01116437    AHZZ02030739    JSUE03037923    GEDC01003168    JAS34130.1    AACZ04060380    GABC01006592    GABD01003812    GABE01001690    NBAG03000487    JAA04746.1    JAA29288.1    JAA43049.1    PNI20010.1    KK116918    KFM69084.1    BABH01021160    BABH01021161    BABH01021162    BABH01021163    GEGO01006047    JAR89357.1    GEBQ01017560    JAT22417.1    KK120039    KFM77390.1    KK115494    KFM65244.1    BABH01041064    GECU01037003    GECU01013756    JAS70703.1    JAS93950.1    ABLF02006169    ABLF02055685    GEBQ01012026    JAT27951.1    CCAG010009903    GEBQ01027849    JAT12128.1    NEVH01006795    PNF36382.1    AB300556    BAF82019.1    NEVH01018384    PNF23441.1    NEVH01024959    PNF16251.1    NEVH01015302    PNF27192.1    GECU01003439    JAT04268.1    NEVH01025150    PNF15655.1    NEVH01006740    PNF36596.1    GEDC01002971    JAS34327.1    NEVH01009368    PNF33480.1    NEVH01008275    PNF34265.1    NEVH01005303    PNF38748.1    AB300558    BAF82021.1    BABH01028864    LSMT01000021    PFX32631.1    GL439981    EFN66430.1    GECU01033435    GECU01003618    JAS74271.1    JAT04089.1    NEVH01017534    PNF24104.1    ABLF02028028    HAEI01002033    SBR78690.1    RJVU01079141    ROI15640.1    GBBI01004439    JAC14273.1    HAEA01000274    SBQ28754.1    HADZ01012453    SBP76394.1    HAEH01008939    SBR85849.1    AB300557    BAF82020.1    GEBQ01031648    JAT08329.1    GECZ01016293    JAS53476.1    GEBQ01020417    GEBQ01019545    JAT19560.1    JAT20432.1    HAAD01001920    CDG68152.1    GEBQ01031067    JAT08910.1    KK116466    KFM67844.1    GDQN01004768    JAT86286.1    KK118194    KFM72419.1   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
PF01094   ANF_receptor
PF05225   HTH_psq
PF02017   CIDE-N
Interpro
IPR029526   PGBD        + More
IPR032718   PGBD4_C_Znf-ribbon       
IPR028082   Peripla_BP_I       
IPR001828   ANF_lig-bd_rcpt       
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR003508   CIDE-N_dom       
SUPFAM
SSF53822   SSF53822        + More
SSF46689   SSF46689       
SSF57667   SSF57667       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
476
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.43064
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01947
outside
1  -  476
 
 

Population Genetic Test Statistics

Pi
417.256773
Theta
235.474135
Tajima's D
3.202493
CLR
0.514347
CSRT
0.985350732463377
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号