SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03024
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.88
 

Sequence

CDS
ATGGACAAGTTGCGCTGGGACGTCATTGGTTTATCAGAAATCCGAAGACAGGGAGAGGATACGATAACCTTGCAGTCCGGCCACTTGTTCTTTTACCGAGAGGGAGAGCAGAAGTCCCAAGGTGGTGTTGGTTTTATCGTCCACAAGTCTCTCGTGAACAACATTGTGTCCGTCGGGAGCGTCTCGAATAGGGTAGCGTGCCTGATACTCAGAATATCGAAACGATATTCATTGAAGGTCATACAGGTTTACGCTCCCACTCAGACACACCCAGACGATGAGGTAGAAGCTTTGTATGAGGACGTCAGTAGGGCCATACATAGCTCCAAAACACATTTTACTGTTGTTATGGGAGACTTTAATGCAAAGCTGGGTTGTAGAAGCAATGATGAGTTGAAAGTGGGTCAGTTTGGATATGGGCAGCGGAACTCCAGAGGACAGAGGTTGGCCGACTTTCTGGAGAAAGAAGGACTCTATATGATGAATTCTTTCTTCCAGAAGCCGCCTCACAGGAAATGGACCTGGATGAGTCCCGACGGTGTAACCAAAAATGAGATCGATTTCATCATGAGCACCAGTAGACAGATATTCAATGATGTCTCTGTGATCCATAGAGTAAAAACCGGAAGCGATCACCGAATTGTAAGGGCCATATTGAGTATTAATGTCAGATTGGAAAGATCGCGTCTGATGAAGTCCACGCTCCGACCACCAAATGCACATATTCAAAACCCCGAGAGTTTTCAACTCGAATTATCTAATCGCTTCGAAGGACTAGACAGCAAGTTATCAGTGGATGATATCTACAGCAGGCTGGTGGAAACTGTCCATACGGTAGGGTCTAAGTATTTTAAAGCCCACCGCAAAAATAGACCTCAAAAATTATCTGACTACACCCGGAACCTCATGGCTAGCCGACGTTCTATGACACTCCAAACTTCTGAGGAAGCTGAGTCATATAGGCAGCTCAATAGACAAATCACGAAGTCCATGCGACACGACCTACGCTCCTTTAATACACAACGTATTAAGGAAACTATTGAGCGGAACCAAGGCTCCAGAGTCTTTGCAAGAGACGTGTCTATTGGGCAGAGCCACTTGACAAATCTGAAAACCGAAGATGGACGTGTAACGTCGAATAAGGCCGAGGTGCTACGGGAGATAGAAAGATTTTATGGGCAGTTATACACCTCGATATCCAATGAGCCTGCAAGCTCGGTTACAGACCCTAGAGCCAAGTTAACCCGACACTATACCGAGGATATCCCGGACATCAGCCTGTACGAGATTAGGATGGCCCTCAAACAGCTCAAGAACAACAAGGCGCCGAGCGAGGATGGAATCACCACAGAGCTTTTGAAAGCGGGCGGGACGCCGGTACTGAAAGTCCTTCAGAAGCTATTTAATTCCTCCTTGCTCAAAGGGAAAACGCCGGAGGCATGGAACAGGGGTGTTGTGGTTTTGTTTTTCAAAAAAGGCGACAAATCCTTATTGAAGAACTACAGGCCCATAACACTGCTGAGCCATGTCTATAAGCTGTTTTCGAGAGTCATCACGAACCGTCTCGAACGCAGGCTCGATGACTTTCAGCCTATCGAACAAGCCGGTTTCCGAAAAGGCTTTAGCACCATAGACCACATACATACGCTGCGGCAGATTATACAAAAGACCGAAGAGTATAATCGGCCCCTATGCCTGGCGTTTGTGGACTATGAAAAGGCCTTTGATTCTGTCGAAACTTGGGCGGTCCTTAGATCTCTCCAGCGATGCCGTATTGACTATCGGTATGTCGAGGTGTTGAAGTACTTGTATAATAACGCCACAATGTCAGTCCGAGTACAGGAGCATTGCACGAAGGAAATCACGCTTAAAAGAGGAGTTAGACAGGGAGATGTCATATCCCCGAAACTGTTTACCGCTGCCTTAGAGGATTCCTTCAAGCTTCTGGAATGGCAAGGATTTGGCATCAATATAAACGGCGAATACATCACACACCTTCGATTTGCTGACGATATAGTAGTCATAGCTGAGTCGCTGGAAGATTTGGGATAG
Protein
MDKLRWDVIGLSEIRRQGEDTITLQSGHLFFYREGEQKSQGGVGFIVHKSLVNNIVSVGSVSNRVACLILRISKRYSLKVIQVYAPTQTHPDDEVEALYEDVSRAIHSSKTHFTVVMGDFNAKLGCRSNDELKVGQFGYGQRNSRGQRLADFLEKEGLYMMNSFFQKPPHRKWTWMSPDGVTKNEIDFIMSTSRQIFNDVSVIHRVKTGSDHRIVRAILSINVRLERSRLMKSTLRPPNAHIQNPESFQLELSNRFEGLDSKLSVDDIYSRLVETVHTVGSKYFKAHRKNRPQKLSDYTRNLMASRRSMTLQTSEEAESYRQLNRQITKSMRHDLRSFNTQRIKETIERNQGSRVFARDVSIGQSHLTNLKTEDGRVTSNKAEVLREIERFYGQLYTSISNEPASSVTDPRAKLTRHYTEDIPDISLYEIRMALKQLKNNKAPSEDGITTELLKAGGTPVLKVLQKLFNSSLLKGKTPEAWNRGVVVLFFKKGDKSLLKNYRPITLLSHVYKLFSRVITNRLERRLDDFQPIEQAGFRKGFSTIDHIHTLRQIIQKTEEYNRPLCLAFVDYEKAFDSVETWAVLRSLQRCRIDYRYVEVLKYLYNNATMSVRVQEHCTKEITLKRGVRQGDVISPKLFTAALEDSFKLLEWQGFGININGEYITHLRFADDIVVIAESLEDLG

Summary

EMBL
FJ265544    ADI61812.1    FJ265543    ADI61811.1    FJ265549    ADI61817.1    + More
FJ265542    ADI61810.1    FJ265545    ADI61813.1    FJ265550    ADI61818.1    FJ265551    ADI61819.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    JARK01001351    EYC23458.1    JARK01001354    EYC21713.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001565    EYB89683.1    JARK01001337    EYC34625.1    EYC21986.1    JARK01001655    EYB84321.1    ODYU01008249    SOQ51673.1    JARK01001353    EYC22263.1    JARK01001415    EYC05858.1    JARK01001462    EYB98944.1    CAVP010059514    CDL95876.1    JARK01000388    EYC37469.1    JARK01000173    EYC41342.1    GDKW01001596    JAI54999.1    JARK01001370    EYC16150.1    DS270843    EFO97547.1    JARK01001736    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    GBBI01004877    JAC13835.1    FJ265562    ADI61830.1    DS268444    EFP01729.1    EYC16376.1    DS268591    EFO92565.1    JARK01001438    EYC02111.1    JARK01001435    EYC02496.1    FJ265564    ADI61832.1    JARK01001421    EYC04912.1    EYC33297.1    JARK01001359    EYC20105.1    JARK01000302    EYC38674.1    JARK01001531    EYB92324.1    JARK01000802    EYC34990.1    JARK01001497    EYB95322.1    JARK01000008    EYC46079.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01000109    EYC42952.1    JARK01000063    EYC44387.1    JARK01001475    EYB97550.1    JARK01001340    EYC30744.1    JARK01001389    EYC10874.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001401    EYC08686.1    JARK01001711    EYB81734.1    JARK01001357    EYC20551.1    DS268752    EFP01106.1    JARK01000132    EYC42415.1    JARK01001344    EYC28216.1    JARK01001372    EYC15614.1    JARK01001581    EYB88505.1    JARK01001384    EYC12189.1    JARK01000161    EYC41641.1    JARK01001543    EYB91356.1    JARK01001395    EYC09729.1    JARK01000165    EYC41537.1    JARK01001612    EYB86585.1    EYC09730.1    JARK01001407    EYC07212.1    JARK01000078    EYC43871.1    AF054983    AAC72298.1    JARK01001505    EYB94618.1    GBBI01004876    JAC13836.1    JARK01001500    EYB95049.1    JARK01001346    EYC26445.1    JARK01001459    EYB99276.1    JARK01001524    EYB92970.1    EYB94617.1    JARK01001582    EYB88498.1    EYB99275.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF05047   L51_S25_CI-B8
PF10328   7TM_GPCR_Srx
PF00069   Pkinase
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR016186   C-type_lectin-like/link_sf       
IPR016187   CTDL_fold       
IPR007741   Ribosome/NADH_DH       
IPR036249   Thioredoxin-like_sf       
IPR001507   ZP_dom       
IPR019430   7TM_GPCR_serpentine_rcpt_Srx       
IPR017452   GPCR_Rhodpsn_7TM       
IPR011009   Kinase-like_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR017441   Protein_kinase_ATP_BS       
IPR000719   Prot_kinase_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF56436   SSF56436       
SSF52833   SSF52833       
SSF56112   SSF56112       
Gene 3D
PDB
6AR3     E-value=0.0177065,     Score=92

Ontologies

Topology

Length:
683
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0321400000000001
Exp number, first 60 AAs:
0.01901
Total prob of N-in:
0.00171
outside
1  -  683
 
 

Population Genetic Test Statistics

Pi
227.505672
Theta
170.069977
Tajima's D
1.141414
CLR
0.584882
CSRT
0.690165491725414
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号