SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03023
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.351
 

Sequence

CDS
ATGGAACAATACGTCGAATGTGGTTCAAGCAGCGGGGCAAGCACACCGAAGAAGACTTCTACCCCAAAAAAGCGGCGAAATCTAAGTCCGCGTAGTAACGATTCTACCCCAAAAAAGCGCCGAAATCTAAGTCCGCGTAGTGACGATCCTAGCCCAAAAAAGCGTCGAAATCTAATCAATTCGTTCAGTGACAGACCCCGCCATGATTCTGAAATAACCACTGCACTTAATTATGGCAGCGAAGAAGAGTCTGACGAAGAGGAAGAAGGGATTGCCGAGTTAGCGGTGCCCCGAATAGCAAGAATGTTTATGGACGAAGACGATGCGGAAGTCAACGAAAGATCCTCCAACGCTACTTTGGAGCGGTCCCCTCAATCGCCTCGACCAGCCGATTGTGCTTCAACGCCCGCCTCACCGACGCCTGTTTCGCCGACTGCCATGGAACCCAGCAACAAATTTCAATTTGAATGGAGAAAGTTTTCAACGCCTCAAATTGAACCTCATTTGAGGCGAGAACCGTTCTCGCAAATTAGTGGCCCTACAGTTTCTTTCACGAGACCATACGAAGCATTTATTGCCATATGGGATCGTGAAATTATGGAAATGATTGTCAGGGAAACTAACATTTACGCACAGCAGCTGGCAACGACCATGTTGGAGAATGGAACGATCTGTCCTAGTAGTCGAATTACTCGTTGGCATGATACAAATGTAAATGAACTTTACACGTATTTTGCCATCGTTCTGGCTATGGGAGTGGTGATCAAAAGCCGGTTAAACGAATACTGGAATACCTCTAACGACATCTTCAGTACTCCTGGCTTTTCCACGAAGATGTCACTTGACAGATTCTACCTTCTGTCAGCATGTCTGCATTTTAATAATAATAAAGATTGTAACTCTGCGTTGTTGACACGACCCCAAGCTAAACTTTTTAAAATTAAACCTATAATAGATCACCTTAATCGCAAGTTTTCTGAATTATATAGTTTGTCTCAAAATGTGGCTCTCGATGAGAGTCTGACCATGTGGAAGGGCTGGCTTGAAATAAATCAGTTCATCCCTAACAAAGCAGCCACAGTTGGAATCAAAACCTTTGAATTGTGCGAATCTCAGACTGGTTATTTGTGGCGTTTTGAAGTATACGCAGGCCATGACACCTCGGCATTTCAAGAAGATGATCCAGTCTCGGGGAAAGTACCAGCTCTAGTGCTCAGACTTTTAAATGGTCTTGAACATAAAGGGCACACAATATGGATGGACAATTACTACAACTCTCCATCACTGGCACGAGAACTGAAGATCCGGGGATTTGACTGCGCGGGGACGCTCCGGACAAACCGTCAATTCGTACCACCTGAATTGGCGAGTATTACAAAAAACGACATGATTGTCGGTCAATTGTTGGGATGCACCTCTGGAGATGTGGACATTGTGGTGTGGAGGGATAAAAACCTCGTGGCTTTTATTTCAACATACCATGCTCTCCTAGCTACCAAGTGTGGCGATACAGTTAAGCCGACAGTCGCGCAGGACTATAATCTTAATATGGGCGGAGTAGACCGTAAGGATCAGCAACTCGCAATGTACCCTTTAGAAAGAAAAAGGCATAAGGAGACTGGGAATGTCAGAAACAGCAATGCTGAATTAACTTTGAAAACCAATGATAGAATAATAACTTCTCATCAAGAAGTGGCCAGTGCCTTTGTGCGCTACTTTGCTGATATCCCAGCTTCTACTACAAAATCTTTAATTTCATCTCCTACCGTCGCCGAATCATTACTGCAAGATCATGTTGATAAATGCAGTGTTAACTTTAAGTGCACAAATATTGATATAAAGGACATAATTGGCTTGGGAGGAATCGCATAA
Protein
MEQYVECGSSSGASTPKKTSTPKKRRNLSPRSNDSTPKKRRNLSPRSDDPSPKKRRNLINSFSDRPRHDSEITTALNYGSEEESDEEEEGIAELAVPRIARMFMDEDDAEVNERSSNATLERSPQSPRPADCASTPASPTPVSPTAMEPSNKFQFEWRKFSTPQIEPHLRREPFSQISGPTVSFTRPYEAFIAIWDREIMEMIVRETNIYAQQLATTMLENGTICPSSRITRWHDTNVNELYTYFAIVLAMGVVIKSRLNEYWNTSNDIFSTPGFSTKMSLDRFYLLSACLHFNNNKDCNSALLTRPQAKLFKIKPIIDHLNRKFSELYSLSQNVALDESLTMWKGWLEINQFIPNKAATVGIKTFELCESQTGYLWRFEVYAGHDTSAFQEDDPVSGKVPALVLRLLNGLEHKGHTIWMDNYYNSPSLARELKIRGFDCAGTLRTNRQFVPPELASITKNDMIVGQLLGCTSGDVDIVVWRDKNLVAFISTYHALLATKCGDTVKPTVAQDYNLNMGGVDRKDQQLAMYPLERKRHKETGNVRNSNAELTLKTNDRIITSHQEVASAFVRYFADIPASTTKSLISSPTVAESLLQDHVDKCSVNFKCTNIDIKDIIGLGGIA

Summary

Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
Interpro
IPR029526   PGBD        + More
IPR032718   PGBD4_C_Znf-ribbon       

Ontologies

GO

Topology

Length:
623
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.599479999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03209
outside
1  -  623
 
 

Population Genetic Test Statistics

Pi
368.60983
Theta
195.700538
Tajima's D
2.826016
CLR
0.405319
CSRT
0.967451627418629
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号