SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03007  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA003607
Annotation
PREDICTED:_STE20/SPS1-related_proline-alanine-rich_protein_kinase_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 2.066 Nuclear   Reliability : 1.711
 

Sequence

CDS
ATGGCTACCTCCGGTAACTCGTGGCCTAACAGCCAGGATGATTATGAACTGATGGAAGTGATCGGGGTCGGGGCCACGGCCGTCGTGCACGCCGCCTTCTGCCGCCCGCGGGGAGAGAAGTGCGCCATCAAGCGTATCAACCTCGAGAAATGGAACACCTCCATGGATGAACTGCTCAAAGAGATTCAGGCCATGTCAAGCTGCAACCACGAAAATGTCGTCACCTATTACACCAGCTTTGTGGTAAAAGAAGAACTGTGGCTCGTTCTGAGACTTCTCGAAGGAGGAAGTCTTCTTGACATCATCAAACATAAGATGAGGATCTCCAACTGTAAACATGGAGTATTTGATGAAGCGACCATCGCCACGGTTCTCAAGGAGGTGCTTAAAGGATTAGAATACTTCCATCAGAACGGGCAAATTCACAGGGATATTAAAGCAGGAAATATCCTCCTCGGTGATGATGGAACCGTCCAGATCGCCGACTTCGGTGTGTCTGCATGGCTCGCGACCGGCCGGGACTTGTCCAGACAGAAGGTGCGACATACATTCGTCGGGACGCCTTGTTGGATGGCTCCCGAGGTCATGGAACAAAATCACGGTTATGACTTCAAAGCGGATATCTGGTCGTTCGGCATCACCGCGATCGAGATGGCCACCGGCACCGCCCCGTACCACAAGTACCCACCGATGAAGGTACTCATGCTCACGTTGCAGAATGACCCGCCAACACTCGACACCGGCGCCGAGGAAAAAGATCAGTACAAAGCGTACGGTAAGACTTTCAGGAAAATGATATCGGAGTGTCTCCAGAAAGATCCAACGAAACGACCTTCGGCGCCGGAACTGCTCAAGCACTCGTTTTTCAAGAAAGCAAAGGATCGAAAGTATCTCGTGCAGACGCTCGTCTCGAACGGCCCGAGCATGGAGACGCGCGTGCACAAGGCCAGCAAGCGACAACCTGGAGCCTCCGGTCGTCTGCATCGCATGGAGACCGGGGAGTGGGTGTGGGAGAGCGACGACGAAGAGGACGAGGACGATGACGCCGCCAGGGACCGACCCATGAACACCCTCGCACGTGCAGACTCCTCCGACTCCGAGGGTGAGGAGCTTGGCGAAGGTCGCGCTGGTTTCACGATCGGTTCGCTCACTGGTGGCGAGGCTCCACAGATCGACCTCGTATTGCGCATGCGTAATTCTAAGCGCGAGCTGAACGACATCCGGTTCGAATTCTCGGCCGGCAAGGATTCCGCCGACGGCATCGCCACGGAGCTGGTGGGTGCGGGGCTGGTGGAGGCGCGGGACGCCGCGTGCATCGCCCGACACCTCCAGCGGCTGGTGGACGCGCGCCTGTTCCCCGGCTCGGCGCCCCCGCCGCGCTCGCTCACCTTCCGGCTGGACTCTGCGGACCCGGCCGCGCCCTCCGACGAGAGCACGCTGCTCGGGTTCGCGCAGATCTCTGTAGTGGACTAA
Protein
MATSGNSWPNSQDDYELMEVIGVGATAVVHAAFCRPRGEKCAIKRINLEKWNTSMDELLKEIQAMSSCNHENVVTYYTSFVVKEELWLVLRLLEGGSLLDIIKHKMRISNCKHGVFDEATIATVLKEVLKGLEYFHQNGQIHRDIKAGNILLGDDGTVQIADFGVSAWLATGRDLSRQKVRHTFVGTPCWMAPEVMEQNHGYDFKADIWSFGITAIEMATGTAPYHKYPPMKVLMLTLQNDPPTLDTGAEEKDQYKAYGKTFRKMISECLQKDPTKRPSAPELLKHSFFKKAKDRKYLVQTLVSNGPSMETRVHKASKRQPGASGRLHRMETGEWVWESDDEEDEDDDAARDRPMNTLARADSSDSEGEELGEGRAGFTIGSLTGGEAPQIDLVLRMRNSKRELNDIRFEFSAGKDSADGIATELVGAGLVEARDAACIARHLQRLVDARLFPGSAPPPRSLTFRLDSADPAAPSDESTLLGFAQISVVD

Summary

EMBL
BABH01007424    KQ459597    KPI95109.1    KQ461187    KQ459677    KPJ07351.1    + More
KPJ20479.1    NWSH01003361    PCG66480.1    ODYU01003719    SOQ42850.1    JTDY01001024    KOB75097.1    GANO01001709    JAB58162.1    KQ971343    EFA04100.2    GFDF01006738    JAV07346.1    GFDF01006739    JAV07345.1    GEZM01001649    JAV97621.1    GFDF01006740    JAV07344.1    NWSH01000478    PCG76114.1    GFDF01006741    JAV07343.1    AGBW02007730    OWR54652.1    CH477776    EAT36321.1    AJWK01002765    JXUM01105128    JXUM01105129    JXUM01105130    JXUM01105131    GALA01001193    JAA93659.1    GFDL01013102    JAV21943.1    GFDL01013185    JAV21860.1    AJVK01026458    AJVK01026459    DS232455    EDS42036.1    ODYU01002745    SOQ40627.1    DS235830    EEB18040.1    AGBW02008204    OWR54034.1    UFQS01003329    UFQT01003329    SSX15513.1    SSX34879.1    NEVH01018373    PNF23646.1    GEZM01001647    JAV97623.1    GFTR01006560    JAW09866.1    CH902617    KPU79838.1    KK852543    KDR21690.1    GEDC01029816    JAS07482.1    GEDC01022382    JAS14916.1    GBGD01001333    JAC87556.1    GALA01001720    JAA93132.1    JRES01001362    KNC23354.1    KPU79836.1    KPU79839.1    CH954181    EDV48590.1    CH480820    EDW54636.1    AF006640    AAD01275.1    OUUW01000013    SPP87991.1    AE014297    BT003198    BT021945    AAF55567.2    AAN13778.1    AAO24953.1    AAX51650.1    ACL83535.1    ACL83536.1    ACL83537.1    AHN57394.1    ALI30588.1    ALI30589.1    CH964272    EDW84526.2    KK107503    EZA49553.1    KQ435798    KOX73362.1    GL449511    EFN82563.1    KQ981301    KYN43053.1    JR039298    AEY58624.1    GGFK01001187    MBW34508.1    GGFK01001196    MBW34517.1    ADMH02001359    ETN62842.1    CM000070    EAL27673.4    CP012526    ALC46314.1    KQ976402    KYM92288.1    GGFM01006759    MBW27510.1    GGFJ01003798    MBW52939.1    GBHO01045182    GBRD01004952    GBRD01004951    GDHC01006505    JAF98421.1    JAG60869.1    JAQ12124.1    GBRD01004949    GDHC01021265    JAG60872.1    JAP97363.1    JR039297    AEY58623.1    GBRD01004950    JAG60871.1    ATLV01024255    KE525350    KFB51107.1    KQ414670    KOC64347.1    QOIP01000006    RLU21966.1    KZ288204    PBC33284.1    KQ982138    KYQ59686.1    KQ977743    KYN00171.1    ADTU01006165    ADTU01006166    ADTU01006167    ADTU01006168    ADTU01006169    ADTU01006170    AXCM01007456    AAAB01008807    EAA04686.4    AXCN02000582    KQ762329    OAD55960.1    CVRI01000019    CRK90511.1    CM000364    EDX12438.1    APGK01046715    KB741067    ENN74404.1    LJIJ01002640    ODM89438.1    GL888037    EGI68962.1    ACPB03007618    KQ434781    KZC04504.1    ABLF02035510   
Pfam
PF12202   OSR1_C        + More
PF00069   Pkinase
PF00149   Metallophos
Interpro
IPR011009   Kinase-like_dom_sf        + More
IPR017441   Protein_kinase_ATP_BS       
IPR028749   Oxsr1       
IPR024678   Kinase_OSR1/WNK_CCT       
IPR000719   Prot_kinase_dom       
IPR041805   ASMase/PPN1_MPP       
IPR011001   Saposin-like       
IPR029052   Metallo-depent_PP-like       
IPR008139   SaposinB_dom       
IPR004843   Calcineurin-like_PHP_ApaH       
SUPFAM
SSF56112   SSF56112        + More
SSF47862   SSF47862       
Gene 3D

Ontologies

Topology

Length:
490
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.42066
Exp number, first 60 AAs:
0.96116
Total prob of N-in:
0.00724
outside
1  -  490
 
 

Population Genetic Test Statistics

Pi
230.259266
Theta
237.449391
Tajima's D
0.103323
CLR
30.74195
CSRT
0.394380280985951
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 HTFVGTPCWMAPEVMEQDHGYDFK 100.00 7e-14
28467696 HTFEPIGQNVTHCNK 95.83 5e-13
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号