SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02998
Pre Gene Modal
BGIBMGA003614
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.15
 

Sequence

CDS
ATGTACACGCAAAAGGAAACCATGAAGGAAGTGAAGGATGCGTCCAAGAACTTGATGGGTGGTGATTTTGAGAGGCAGTACGGAGGCCCGACAATGAACAAGTGCGATCGGCGAATGAAAGCTTGGGTAGTGACGGTGACTGCGACTATCATTGGGCTGCTATTGGCGTTGCTTGTTCTGGTAATCGTGAGGGAGATCCACATAGCCCGCTTACGGAGCGAAATCGATGATCTTACTGCAAACATGATTGCGATGTCGGCAAATGTGAAATTACTTAACCAAAAATACAACAACAAACACTTCAACGACTTCAAGCCTATGGAGGATACTATATACGCTGACGAAGACCAAGATCTGAGCACCTTAGAAACTGCCGATAAGGAAGAAGACAAGGATAAATCGAACTACGATTCCCTGGAGAAGCTACACGATATTACGGTCTTGGAGGAGGACAACATCGGAGACGACGAGGACATGCTGGACGTCGCCGACGATCCGGAGAGCGGTGACTGGTATCCTGATTTCGACAAGCGTGCTGATAAAGTTAAGTGGTGTTTCGCTGCAGAAAATTTTTTAGTACTCGAAGGCATGAAGCATTGCATCAAGCCAGAACCGGGGAAAGAAATAGCAAGCGCGGATGACGAAAAAACTAAAGCCAAATTGATCATGACCATCGACCCGTCGTTGTACTGTCCGAGTTTAGAAGCCGAAAAAAGAAAACAATCCAACGCCTTTAGTGCTATTTTCTTAAGTGGAAATTTCAACTGCGATAGTTGGTACATAGATAGCGGGGCCAGCAAACACATGACAGCAAAGAAAGAATACGTTGAGAGTCCATCATTTGAACATGAAATTAAAGAAATAATTGTGGCGAACAAAACATCCGTCCCGGTAGTGTGTTCTGGTGATGTAAACATAATCACAGTTGTGAATGGTGTAGAATATGACATCACAGTTTCAAATGTATTGTGCATACCGAGTTTAACAACAAACTTGCTTTCAGTGAGTCAGTTAATTGAGAATGGCAATAAGGTAATCTTTAAAGAGAAATTTTGCTATATTTACAATCAACAGAGAACTCTAGTTGGAAAGGCAGAATTAGTAGATGGTGTGTACAGATTATATACTAAGAAATCAGAACAGTTATTCGCAGCCACAGCTAAGGTGTCGAGTGAAACTTGGCATCGACGATTAGGGCATATCAACAGTACCAGCTTGAACAAAATGAAGAATGGAGCTACGACAGGTATTTCATACACAAATAAAGCTGATGTTGACAAATCTAAGTGTACTGTTTGCTGTAAGGGGAAGCAGGCTAGACTACCTTTTCAGCCTAGTTCAACTAATACCCAAGATATTTTAGAATTGATACACTCAGATGTGTGTGGTCCGATGGAAAATGTGTCTATTGGAGGATCCAGATACTATGTCTTATTTGTGGATGACTACAGCAGAATGGTTTTTGTATACTTCATGAAAACAAAGTCAGAGGTATTTAAGTTTTTCAAAGAATTCCAGTCACTTGTAGAAAAACAGACAGATCGGAAAATTAAAATTCTAAGAACAGACAATGGCGGTGAGTACTGCAGTCAAGACTTTGAAAGATATCTAAAACAACACGGAATAATTCACCAGAAAAGTAATGCTTACACACCACAGCAAAATGGTGTGTGTGAAAGGATGAATAGGTCATTAGTTGAAAAGGCTAGATGTTTAATTTTTGATGCTGGTTTACATAAAAAGTTTTGGGCAGAAGCCATAAATACCTCTGTATACTTAAGGAATCGATCAGTTGTTACTGGATTAAACAACATGACTCCATATGAAGCCTGGACAAAGAAAAAACCTGACTTAAGTCATGTACGTATTTTTGGAAGTAAGGTTATGATGCACATACCAAAAGAAAAGCGTTTAAAATGGGATATGAAGGCTAAAGAACTTATTTTGGTAGGCTATGCAGACAATGTAAAAGGCTATAGGGTTTATAACCCAGAAAATAACTCTGTCACAACTAGCAGAGACATTATAATAATGGAAAAAACCGAAAATACAATGGAAATTCCTATTGAGTGCAAAGCTCCAGCGGAGGAACAGAGAGAAGGAGACGAAAGTAGAACTACAGAAAGTACAGACACTGAATGTGACGATAATGATATCACATATATTCCAGAAGCTTCTTCAGTAAGTGACTCATATGACAGTTTTTCTGAAACAGCATCAGAACCAGAACCTTCATTATTAGACTTGAATCAGGATATTCCAAACAAGCGAGTGAGAAAAATACCTGATAGATTTGGCTATAGTCACTTATGTATTGCAGAATCAGATGATCAAAATATAATGGATATTTCACTCAAGGAAGCTTTAAATGGACCTGAAAGTAAATTTTGGAGATCAAGCATGGAGGAGGAATTAGAATCATTTAAGAAAAATGATGCATGGGAACTTGTGGATAAGCCTCGTGACTCTACAGTAGTGCAGTGCAAATGGGTATTTAAAAAGAAGTATGATAGTGTCGGTAATGTGCGTTATCGTGCTAGATTAGTGGCAAAAGGCTTTTCACAGAAAGCTGGCATAGACTATCATGAAACTTTTTCACCTGTGCTACGTTATACTACTTTAAGATTGTTATTTTCTATAGCAGTAAAACTAGGTTTAGATATACGTCATCTTGATGTCACTACAGCCTTTCTAAATGGTTTTTTGAATGAATCTGTGTATATGCAAAAACCTGTCCTTTATAGAGATTGTAATGATAATGATAACAAAGTATTAAAGCTTAAACGTGCCATATATGGACTTAAGCAATCATCTCGTGCTTGGTATCAGAGAGTTAATGATTACTTAGAGTCTTTAGGATATTTAAAATCTAAGTATGAACCGTGTTTGTTTACGAAGTCTGAAGGAAATGCTAAAGTTATAATAGCATTGTTTGTTGATGATTTTTTTGTTTTTTCTAACTGTAAAATGGCAACTAATCAGTTAATACAAGATTTGAGTAGTAAATTTAAAATTAAAGATTTGGGTCAAATAAAGCAATGTTTAGGCTTAAGAGTGAATATGTATAAAAATGCTATAACTGTTGATCAAGAACAGTATATAGAAAGCTTGTTAAAAAAGTTTAACATGTCACATTGTAAAACTATAGAAACTCCTATGGAGATTAATTTAAGATTGGAAAAATCTGAGAATAGTTTATGTAATAAAAATATTCCATATAGACAATTGATAGGTAACTTAATGTATTTAGCTGTGTTAACCAGACCAGACATAGCTTACAGTGTGATGAATTCGAACATGGTGCATCTACGTCCCGACGAAATTGCTGACGCAGTTGCATTCAAGAAGGACAACGAGCTGCTCCTCTCGAACGTGAGGAAAATCAAGAAACTGCTAAACGAGAATCCAGAAAATCCCGATTTGCCGCCACTCCAACCGCCGGACATGACCGAATCTTCAGTGGATAAACGGAACAAACGTAGCGTTTTCGAATCAAGCCCTGAAGTAGATCGATTTCCAGCTCCATATATGGCCACGAAATTAGAAGAAAGACGTAAATCGAAAAAGTTCTTGGGCAGCTTAGAGTCCGCTTCAGCAGCTAAGATGACGATGCACACCGTACCGCGGACAGTCAGGAACAGTGACGATGAGGAACAGAGGCGGCCGTTTATAGCAGCTCATTTCCATGGAAACACATCGCATCTGAACACCGAAGTTCATGAGCATTACAAAGGTAATGGCTTGATAAGAGTGTCTCACGGCGCCCCCCACGACGTGTGGTATCCTTCGCAGTGGACGATATCGTCGCCTCCTCCGCGTCCGACTCTGACGCACTCCGGTCACGTCCGCGTGCACCACACCGGAGTCTACCTCGTCTACGCTCAGATTTACTACCTGGACAGTCACGACGTGATATCTTGGGTATTGCACCGTACGAATCCTGAGTCGGATGGAAGAGACACCCTTCTTCAATGTGCACAATCATCCCACTCTACGGAAGTTCTCGACAAACCAAATTCCTGTTTCTCTGCATCAGCTCTGTTCCTCAGAGCTGGCGACAGACTCGCCGTTAGGAACACCGGCGGAGATAGACACTCTCTCATGCAGCCAGAGAAAAGCTTCATAGGTCTCATTAAATTGGCTGACGCCGAAGATCCGGCGCAAGACCTGTAG
Protein
MYTQKETMKEVKDASKNLMGGDFERQYGGPTMNKCDRRMKAWVVTVTATIIGLLLALLVLVIVREIHIARLRSEIDDLTANMIAMSANVKLLNQKYNNKHFNDFKPMEDTIYADEDQDLSTLETADKEEDKDKSNYDSLEKLHDITVLEEDNIGDDEDMLDVADDPESGDWYPDFDKRADKVKWCFAAENFLVLEGMKHCIKPEPGKEIASADDEKTKAKLIMTIDPSLYCPSLEAEKRKQSNAFSAIFLSGNFNCDSWYIDSGASKHMTAKKEYVESPSFEHEIKEIIVANKTSVPVVCSGDVNIITVVNGVEYDITVSNVLCIPSLTTNLLSVSQLIENGNKVIFKEKFCYIYNQQRTLVGKAELVDGVYRLYTKKSEQLFAATAKVSSETWHRRLGHINSTSLNKMKNGATTGISYTNKADVDKSKCTVCCKGKQARLPFQPSSTNTQDILELIHSDVCGPMENVSIGGSRYYVLFVDDYSRMVFVYFMKTKSEVFKFFKEFQSLVEKQTDRKIKILRTDNGGEYCSQDFERYLKQHGIIHQKSNAYTPQQNGVCERMNRSLVEKARCLIFDAGLHKKFWAEAINTSVYLRNRSVVTGLNNMTPYEAWTKKKPDLSHVRIFGSKVMMHIPKEKRLKWDMKAKELILVGYADNVKGYRVYNPENNSVTTSRDIIIMEKTENTMEIPIECKAPAEEQREGDESRTTESTDTECDDNDITYIPEASSVSDSYDSFSETASEPEPSLLDLNQDIPNKRVRKIPDRFGYSHLCIAESDDQNIMDISLKEALNGPESKFWRSSMEEELESFKKNDAWELVDKPRDSTVVQCKWVFKKKYDSVGNVRYRARLVAKGFSQKAGIDYHETFSPVLRYTTLRLLFSIAVKLGLDIRHLDVTTAFLNGFLNESVYMQKPVLYRDCNDNDNKVLKLKRAIYGLKQSSRAWYQRVNDYLESLGYLKSKYEPCLFTKSEGNAKVIIALFVDDFFVFSNCKMATNQLIQDLSSKFKIKDLGQIKQCLGLRVNMYKNAITVDQEQYIESLLKKFNMSHCKTIETPMEINLRLEKSENSLCNKNIPYRQLIGNLMYLAVLTRPDIAYSVMNSNMVHLRPDEIADAVAFKKDNELLLSNVRKIKKLLNENPENPDLPPLQPPDMTESSVDKRNKRSVFESSPEVDRFPAPYMATKLEERRKSKKFLGSLESASAAKMTMHTVPRTVRNSDDEEQRRPFIAAHFHGNTSHLNTEVHEHYKGNGLIRVSHGAPHDVWYPSQWTISSPPPRPTLTHSGHVRVHHTGVYLVYAQIYYLDSHDVISWVLHRTNPESDGRDTLLQCAQSSHSTEVLDKPNSCFSASALFLRAGDRLAVRNTGGDRHSLMQPEKSFIGLIKLADAEDPAQDL

Summary

Uniprot
ProteinModelPortal
PDB
3K48     E-value=9.6148e-07,     Score=131

Ontologies

Topology

Length:
1390
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.85274
Exp number, first 60 AAs:
19.8793
Total prob of N-in:
0.99997
POSSIBLE N-term signal
sequence
inside
1  -  40
TMhelix
41  -  63
outside
64  -  1390
 
 

Population Genetic Test Statistics

Pi
175.14668
Theta
160.69982
Tajima's D
-2.369552
CLR
13.033318
CSRT
0.00209989500524974
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号