SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02980
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.09 Nuclear   Reliability : 1.482
 

Sequence

CDS
ATGATGGCAAACTTAAAAATAAAATTACCCCAGGAGGGTACCACCCTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGGAGCATGCTGCCCCGCGTATTCTGGGGGGGGCAAAGCATGCCACGATGAAGGGGGCTGTGCGACGGGTAGCGGAAAACCCGTCGAACCGAGGTGTGACAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGAAGGCGAGGCGGCTGGTCCGAAAGGGACAACCGCCAAGAAGATTAGGCGGAAGAGGAAGTCTTGGCGAGCTTCCTCTCGTGAGGGGGTAGGGGAGCCAGCGTCATCCTCTGGCGCAGATGCCCCGCCGGAAAAGGTGTTGGTAATCTCCGATGCAGCCTCTGCTGCGGAGGAGATGCCGCCCCCTAGAGGGAGACCCGCCCGGAAAAGGGGCGCGCCGTCACCGGCGCCATCATCAGTGTCAATGTCTGTCGCCTCGTTGGATGGGCAGACGACAGAGGAGGAAGAGAGCGGCCTTCAGGATCCTGCCATGGTCATAGACAGGGCCATGAAGACCGTGAAATCATACGCGGCCAATGGCACCAAGACCAAAGCCGCTGGTCGTAAACTGCGAGAAGTGGTCTCGCAGGTCTCGAAAGTTCTGCCATCAGTTGCTTCTGCCAATGACCAGGTGGTACAGCTGATGGCGGAGAATTCGAGACTTCGAGCACAGCTCCAAGCTCGGCAACGGCCCGATGATGGAGCAGCGACGTCCTGGGTCGCTGGAGCCCTTCGGAGCTCCCGTCTCCTGGCGCTGACTGGTGATCAGTGGCCTGTGCTGCCACCACCGCGTGCGGCACAGGAGCGTCCGCGTCTCCCGTCACCGCGCTCTAGAGAGACGACCGCCGCCGCGCGGCAGCAAGCACTCGCGGGGCCACGGATGCTGGCTCCGCCAGAACCGAAGACCTTCAGCCTGGACGAGGTCATCAACCGCACCGTCCAGGCTGTAGTAGAAAAGCTGGGCGGGAGGCTAGCGGCTCTCGAGGCGAGAGTGACTGTTTCGGCCGACGTTAGGCAACCGGCGGTGACGGGTGCTTTGGCCACCCGTTCCGCTCCCGTACGGGCTCCGGCCACCAGGTCGGGCCCGGGACGGGATCGAACTAAGCGAGGGGGCGGCGCTAACGCGAAGCCTCCATCACAAGCACCCCAGTCCCGTCCGCTGCCTCCGCCCCCGTCAGACATGGACGAGGGGTGGAACGTGGTGGCCCGGCGGGGTGCCAAAAAGGCCTCACTGGCAGCTCCCCAAATGGGTAGAGCGCCAGTGGCCATGGCGGTTCAGGCTGCACCCCTGACCCAACAGGGTCGAGCACCTGTAGCCGCCAAGAAAAACAAAAAAACAAAAAAAAAAGGGAAGAAGTCGTCGCGGGCGCCGCGATCAGCGGCAGTGGTTCTAACTTTACTGCCTGCCGCTGAGGCCAAGGGCATCACATATAATGATGTGATGGCCCGGGCGCGTGAAGCAGTCAACCTGGACGAGATTGGGGCGGAGGAGGGCCTCCGCAGCAGGCAGACGGCCAATGGGGCCAAGCTGTTAGAGTGTCCCGGTGCCGATAGTCCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTATGGTCTTGCCTGAGGAGGAGGTGCGGGTGCACAGGCCGGTAAAAATGGCGGAATTAAGAGTGACCGGCCTGGACGACTGCACCACCAGGGATGAGGTGAGAGCGGCCGTCGCTACCCAGGGCAACTGTGCACCGGAGAATGTAACCGTGGGTGAGCTGCGCCGTGGTTATAACGGGGCCAGCTCAGTGTGGGTGCGTTGCCCGTTGGAGACGGCTGCCTCCCTGGCTGCTCCTCCGCCCGGGGGACCGTCGGGGAATCCAGGCAGGCTGCGCGTGGGCTGGATAGCGGCCCACGTGCACCTGCTTGAACCACGCGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGACACGGTCTCGCCAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCGCGGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCGGGGCTAACCACCGGGCGGGAGGAAAGGCGTGCCTCCCGTCCGGTGATAACACCGAACGCAACCGGCACCGGAAGTCAAAGCGCCGGCAGAGGAGAAAGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCACCGGTGCCGAAGGGGGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGTATGGCGGAGTGGTCTATAGATGTGGCTGTGGTCGCCGAGCCATATTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGCCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCCCGTCCAGTGATTCTCGCGGGGGATCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCGCTCGGACGCTCGTGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGGGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCACAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGATTGCGTTCGCGGCAGCAGAGGCCCGGCTGCGCGGCGCATTCCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACACTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGTGCTTTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGGCGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGATGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTACGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATAGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACATGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATATGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATTAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGCTAAGCCGGCTTTTGCCCAACGTCGGGGTGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAGGTGGCGGGCTGAACTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCACGGAGGGCCCAATCTCGGCGATCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAAGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTTACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGATGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MMANLKIKLPQEGTTLGGESLRASTSVGACCPAYSGGGKACHDEGGCATGSGKPVEPRCDSAGSTRSALVSEGEAAGPKGTTAKKIRRKRKSWRASSREGVGEPASSSGADAPPEKVLVISDAASAAEEMPPPRGRPARKRGAPSPAPSSVSMSVASLDGQTTEEEESGLQDPAMVIDRAMKTVKSYAANGTKTKAAGRKLREVVSQVSKVLPSVASANDQVVQLMAENSRLRAQLQARQRPDDGAATSWVAGALRSSRLLALTGDQWPVLPPPRAAQERPRLPSPRSRETTAAARQQALAGPRMLAPPEPKTFSLDEVINRTVQAVVEKLGGRLAALEARVTVSADVRQPAVTGALATRSAPVRAPATRSGPGRDRTKRGGGANAKPPSQAPQSRPLPPPPSDMDEGWNVVARRGAKKASLAAPQMGRAPVAMAVQAAPLTQQGRAPVAAKKNKKTKKKGKKSSRAPRSAAVVLTLLPAAEAKGITYNDVMARAREAVNLDEIGAEEGLRSRQTANGAKLLECPGADSPGIAERLAAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVRAAVATQGNCAPENVTVGELRRGYNGASSVWVRCPLETAASLAAPPPGGPSGNPGRLRVGWIAAHVHLLEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCAAAPHCALCAAAGRGANHRAGGKACLPSGDNTERNRHRKSKRRQRRKLARGALANAVIPAAAPVPKGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIAIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPARTLVGESIVDVTFASPAIARRIRDWRVLGGAETLSDHRYIRFDLSARSTVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPIAFAAAEARLRGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSVLFPQEREGFVAPAMDAPPDYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGVPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYRWRAELRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSDVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADIAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=4.77468e-05,     Score=118

Ontologies

Topology

Length:
1779
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.16384
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00002
outside
1  -  1779
 
 

Population Genetic Test Statistics

Pi
128.793982
Theta
107.459787
Tajima's D
2.179956
CLR
0.518542
CSRT
0.908304584770761
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号