SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02969
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.32
 

Sequence

CDS
ATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGATAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCATACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGCCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCAACGGCATCCACAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGAACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGATATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAG
Protein
MSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPYGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLIRPSGQPPAFDDDDKAELLPDALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSNGIHNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEANVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLPESRKAPRSPRYYLVCISMIYPGLRRPI

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    GGMR01015412    MBY28031.1    GGMS01002955    MBY72158.1    S59870    AAB26437.2    L79944    AAB04627.1    RPOV01000134    RPJ78669.1    KK119261    KFM75202.1    GGMR01006581    MBY19200.1    GFXV01007093    MBW18898.1    GGMR01018716    MBY31335.1    GGMR01013409    MBY26028.1    GGMS01000737    MBY69940.1    NEVH01006736    PNF36716.1    KK115285    KFM64681.1    ABLF02040174    ABLF02040183    ABLF02055266    AJWK01012157    KK118005    KFM71947.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NNAY01003095    OXU19992.1    GGMR01002322    MBY14941.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02029306    ABLF02029314    ABLF02060138    GAPW01000276    JAC13322.1    KK113281    KFM59799.1    ABLF02016634    KQ973363    EFA13335.2    GGMS01017365    MBY86568.1    GGMS01000625    MBY69828.1    GGMR01012305    MBY24924.1    GGMR01003407    MBY16026.1    ABLF02024246    GFTR01008279    JAW08147.1    ABLF02034467    ABLF02003242    ABLF02006260    ABLF02042516    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    ABLF02017543    ABLF02017549    ABLF02017551    ABLF02021996    GFTR01008251    JAW08175.1    GGMR01000005    MBY12624.1    GGFJ01002256    MBW51397.1    GGMR01004661    MBY17280.1    GGFJ01002257    MBW51398.1    GGMR01000857    MBY13476.1    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    GFTR01008038    JAW08388.1    GFTR01008256    JAW08170.1    GGMR01011511    MBY24130.1    GFTR01008257    JAW08169.1    GBBI01001646    JAC17066.1    GEHC01001034    JAV46611.1    GEZM01053022    JAV74219.1    GEZM01084970    JAV60359.1    GGMS01002786    MBY71989.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
465
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.31173
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01517
outside
1  -  465
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
5.117436
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号