SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02967
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.497 Nuclear   Reliability : 1.125
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCCCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACATCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACAGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGTCTCGCGGCCTTTGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAGCTGTATGAGCGTCTGCTCTACAAGCGCCTCAGAGATTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTAGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTAGGTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAG
Protein
MKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTARVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLGISEGKLHTDFLPD

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    GGMS01002955    MBY72158.1    KQ973412    EFA12510.2    GGMS01006359    MBY75562.1    GGMR01019198    MBY31817.1    GALX01005359    JAB63107.1    GFXV01007093    MBW18898.1    GBYB01008290    JAG78057.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02028535    ABLF02028545    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02042518    ABLF02057746    GECU01013097    JAS94609.1    ABLF02040174    ABLF02040183    ABLF02055266    ABLF02016634    GBBI01004395    JAC14317.1    RPOV01000134    RPJ78669.1    GGMS01017914    MBY87117.1    GGMS01000625    MBY69828.1    GGMR01004661    MBY17280.1    GFTR01008038    JAW08388.1    ABLF02008463    ABLF02040650    ABLF02040651    ABLF02056776    GGMR01018716    MBY31335.1    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02034467    ABLF02008153    ABLF02008462    ABLF02008464    GGMR01014053    MBY26672.1    ABLF02041767    GGMS01017365    MBY86568.1    ABLF02033757    S59870    AAB26437.2    NEVH01006736    PNF36716.1    GGMR01013409    MBY26028.1    NEVH01010546    PNF32261.1    GFTR01008262    JAW08164.1    L79944    AAB04627.1    GGMR01003407    MBY16026.1    NEVH01021205    PNF19912.1    NEVH01001355    PNF42855.1    GBBI01001699    JAC17013.1    NEVH01002716    PNF41415.1    KK118005    KFM71947.1    NEVH01007838    PNF34986.1    NNAY01003095    OXU19992.1    NEVH01014858    PNF27387.1    KK119261    KFM75202.1    GGMR01000676    MBY13295.1    NEVH01005277    PNF39135.1    GBBI01001646    JAC17066.1    NEVH01019964    PNF22161.1    GFTR01007929    JAW08497.1    ABLF02024246   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
519
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.14713
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04241
outside
1  -  519
 
 

Population Genetic Test Statistics

Pi
19.424172
Theta
15.590896
Tajima's D
-0.669741
CLR
0.793066
CSRT
0.2016399180041
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号