SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02966  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA003573
Annotation
PREDICTED:_uncharacterized_protein_LOC101744237_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.953
 

Sequence

CDS
ATGAGTGGTCTACGATCCGTTCAGGTAGTCAATGTGAATGACAATCACAATTATGTGCTTGAAGATAACACACTCCAGAGAATTTTACTGCGTGAGGATGTAAAAGATCTGCCGCTGGTGGTGGTTAGCGTAGCGGGCGCCTACCGTGGAGGAAAGTCCTTCTTGCTAAGCTACTTCCTCCGCTACCTCAACTCACCGACGGAAAAGCGAAACGAAAATGGCGACTGGTTGGGGAACGAAACAGACCCTTTAATCGGATTCAGCTGGAAGGGAGGATCTGAAAGGCATACTACGGGCATACTAATGTATCCGGAGCCATTTATCACCACTACAGCTGCAGGAGAAAAGGTGGCAGTGCTGTTAATGGATACACAAGGCACCTTCGACTCCAGCAGCACAGTGCGAGATTGCTCCATAATATTTGCGCTCTCTACCCTAATATCGTCCGTTCAGATCTATAATCTCAAAGAGAATCTTCAAGAGGACGATCTTCAATACTTACAGTTATTTACCGAGTACGGGAAACTACTTAAAAACGAAGACGGCTCCAAAGCGTTTCAGATGCTAATGTTCCTTATCAGAGATTGGCCTTACTATTATGAACATGCTTTCGGTGCCAAAGGAGGTGAAGAGCTATTAAAAAAGAGACTTGAAATTACAGATAAAATGCCAAAAGAGCTATGTGACCTCCGGGAACATATTCGTTCTTGCTTCGATAAGGTTTCATGTTTCCTTATGCCTCACCCCGGTTTCAAAGTTTCGAATCCAAGCTACAACGGAAACTTTTCTGAGCTTTCGACAGAATTCAGAAACGCTCTTAAAGAGCTTGTACCGTCTATATTTGCGCCTGAAAATTTGAATATAAAAAAGATAAATGGAGTTAAAGTAACATGCGCTGATATGTATACATATTTCCAAACTTATATGACTGCTTTCAACAGTGATTCTATGATAACTCCTAGCAGTATCTTCGAGAATACCAAGAGGGCGGCATTGATGGCAGCTATTCGGGAAGCTACCAGTAAGTACACGAAGATCATGGATGCTGCGTGCAATACCGACACGCCAAGTATGCCAGGTGAAGGAGTTCGTGTTACTCATAACCAAGCATTGGCTAAAGCAATCGAAGCGTTCAACAAAAAAGGGAAAATGGGCTCACAAAAAGAGATCGGTGCATACCTAACTCAATTAAAGCGTGATTTAGAAGATCAATTACCACGTTATGGCCTTATGAACGACGGCAAGTATCGGAAACTAGCATTCGAAGCAAAAGAAGTATTTGATAATACAGTCAAAGCAGTGCACGGTGAAAATTTATTTTGCTTGCATCCGAATGATGTAGAACCATTGTTCAATGAAGCCGTTTTAGCCGCTTCTACTTACTTTGATTCCAAAAGACAAAAAATTCCAAATGTCATTGATGAAGAAAAGAATAAATTCATCCAGTATTTAGGCAAAGAACTGAAGTGTCTCCAAGCATTAAATCTACAAAACAACAGACACGTTATAACTGAACTCAAGATGAACTTCTCTAGTTTCATGGAAGGCTTAGTCAACAAGGAACCTCCATTAGATGACAACGAATATGAAGCCAAGTACCAAGAAAGCTACAGAAAAGCCATTGAGACATTCGACCAGCGACGAAATAGGCCTACAGAATTTCCAGAAGATGTATTCAAACTATCTCTGATGCAGCACATGGCAGCTCAATTTATTAACTTGCAAGCAATCAATAGAAGTAAAAATAGGAAACAATTCATGATGGCGTTGTCATTCTACACGAATCACATGAGTCTTTTCTGGGATCCCGATACATGCTGCTTACATCCAAACGACTTGGCAAACGAACATAAATTAGCATCAGAACAAGCGTTGAAACTATTTCACCCCGAATTGCCAGATGAGATGGAGAGAGAAATACTTAAACAGTTCATCAAGTCGAAGTATGACGATCTGCGCGAACTGAACGATGCTGCGAATGAAACAGCTATTGCTACAGCTGTTAACGTGTATGTAGAAAAAATGGAGAAAGCCACAGAATTTAAGGGCTGGTGGATCCCAACTTTGGGGATTCCGTATCTTGTCAACCTGGCTAATAGATCTTCCTATCACGAGGAAGCCAAAGAAGCTGCTCTTCTTAATTTCTACTCGAATCGTCGCGATCGCATGAACAGCGCTCCCGATAAATACTACAATGAACTTATTAAGGGCTTGGGCGAAATCCGCCTCCCTGGCCCCCGCTCGAAGGCGGCGGGCCTGTGCGTCTCTCACGCACCCCGCCGCCTCCTTCTGCAAGATGGTGCACTCGCAGAAGTCGATCATCGCCTTCCACGACTCGTCGTCACCGAGCATCGATACCACAACACTCGGCAACGACAAGTCGTTTCGTATTTTTGCGACGAGGACACGGCACCACCCCTCCCATTCGGGGCAGGCGACAAGCGTGTGCTCCGCCGTGTCCAAGTCACAACCACAATGGTGGCACTCTGCCGTCGGCTCGGCTCCGATCCGGTACAGGAACTCACCGAAGCAACCGTGCCCAAAGCAGTTCAGAGTTTGATTATATACTCTTTGCTGCTGTATAGAAAAATTGGACAATTTGAGTACTGGAGAGTCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGAGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTACTGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGGCGGCGCGTTAAGCTGGCTCCTTCCGAATGTTGGGGGGCCTGACCAGGTTACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGTCTGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTCTGGCTGGTCGTAGGACCGTCGAGGCGATTCGCTCGGTTCTTGTGAACTGGGCAATTGAATCTAACAGGTATATTGAAGACCTAATCAATATGAGTGGGCCACGATGCGTTCAAGTAGTTAATAGGAATGAAAATCACAATTATGTGCTTGAAGATAACGCACTCCAGAGAATTTTATTGCGTGAGGATGTAAAAGATCTGCCGCTGATGGTAGTTAGCGTCGTGGGTGCCTACCGTGGAGGAAAGTCCTTCTTGCTAAACTACTTCCTCCGTTACCTCAACTCACCGACGGAAAAGCGAAACGAAAATGGCGACTGGTTGGGGAACGAAACAGACCCTTTAGTCGGATTCAGCTGGAAGGGAGGATTTCAAAGGCATACTACGGGTATACTAATGTATTCGGAGCCATTTATCACCACTACAGCAACAGGAGAAAAGGTGGCAGTGCTGTTAATGGATACACCAGGCCTCTTCGACCCCAACAGCACAGTGCGCGATAGCTCCATAATATTTGCGCTCTCCACCCTAATATCGTCTGTTCAGATCTATAATCTCATCGGGAATCTTCAAGAAGACGATCTTCAGTGGTTACAGGTAGATTTCAATACTCGGCTTATATACCCTGCAGTGGTTCTGAAAACGTGCGCTCCTGAGCTGACGCCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCGCTAACAGGGTTCCGTCTTCATGGAAAACCGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTACAGGCCTATCGCGATAACTTCTTTGCTTTCCAAGGTGATGGAGCGAATAATAAATGTACAACTCCTGAAGTATCTTGAAGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACTCAGCTGGCGATCTTCTTGTATACCTTACTTACAGCACGGGGGATGCGCGATATATCGGTCATCAGAGCCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCTAAGCTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGATGAATTGAACTTGGTTCAGTTCATCCCGTTAAAGACACAAGTTTACGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCGCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAGGCCAAGTTGGCGTCCAAAATGCTGCGAGTCCTCAACAGAACGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCAAGCGTGGAGTACTGCTCCCATCTCTGGGCCAGGGCTCCCAAATACCTGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCACGAATCGTTTGGAACCTCTGGGTCTGTGGAGGGACTTCTGTTGCCTCTGTATTTTGTACTGTATGTTCCAAGGGGAGTACTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCTGCCACCGGAGTAGAGATTGGTTTTACCCTTATGAACATGCTTTCGGTGCCAAAGGAGGTGCCGAGCTATTAAAAAAGAAACTTGAAAATACCAAGAGGGCGGCATTGACGGCAGCTACGCGGGAAGCTACCAGTAAGTACACGAAGATCATGGATTCTGCATGCAATACCAACACGCCAAGTATGCCAGGTGAAGGAGTTCGCGTTACTCATAACCAAGCATTGGATAAAGCAATCGAAGCGTTTAACAAAAAAGGGAAATTGGGCTCACAGAAAGAGATTGATGCATACCTAACTCAATTAAAGCGTGATTTAGAAGAACAATTACCACGTTATGGCCTTATGAACGACGGAAAGTATCGGAAACTAGCATTCGAAGCAAAAGAAGTATTTGATAATACAGTCAAAGCAGTGCACGGTGAAAATTTGTTTTGCTTGCATCCGAATGACGTAGAACCATTATTCAATGAAGCCGTTTTAGCCGCTGTTACTTACTTTGATTCCAAAAGGCAAAAAATTCCAAATGTCTTTGATGAAGAAAAGATTAAATTTATTCAGTGCTTAGGCAAAGAACTGAAGTTTCTCCAAGCGTTGAATCTACAAAACAACAGACACGTTGTAACTGAACTCAAGATGAACTTCTCTAGTTTCATGGAAGGCTTAGTCAGCAAGGATCCTCCATTAGATGACAACGAATATGAAGTCAAGTACCAAGAAAGCTACAGAAAAGCCATTGAGACATTCAACCAGCGACGAAACAGGCCTACAGAATTTCCAGAAGATGTATTCAAACTATCTCTGATGCAGCACATGCCAACTCAATTCACTGACTTAAAAGAAATCAATAGAAGTAAAAATAGGAAACAATTCATGCTGTCGCTGTCATTCTACGTGAATTACATGAGTCTTTTCTGGGATCCCGATACATGCTGCTTACATCCGAACGACTTGGTAAACGAACGTAATTTAGCATTAGAACAAGCGTTGAAACTATTTCACCCCGAATTGCCAGATGACATGGAGAGAGAAATACTTAAACAGTTCATCAAGTCGAAGTATGACGATCTGCGCGAACTGAACGATGCTGCGAATGAAACGGCTATTGCTTCAGCTGTTAATGTGTATATAGAAAAAATGGATAAAGCCACAGAATTTAAGGGCTGGTGGGTCCCAACTTTGGGGATTCCGTATATTGTCAACCTGGCTAATAGATCTTCCTATCACGAGGAAGCCAAGAAAGCTGTTCTTCTTAATTTCTACTCGAATCGTCGCGATCGCATGAACAGCGCTCCCGATAAATACTACAATGAACTTATTAAGGAGATCAACTACGCTCGGATGAAATATTAA
Protein
MSGLRSVQVVNVNDNHNYVLEDNTLQRILLREDVKDLPLVVVSVAGAYRGGKSFLLSYFLRYLNSPTEKRNENGDWLGNETDPLIGFSWKGGSERHTTGILMYPEPFITTTAAGEKVAVLLMDTQGTFDSSSTVRDCSIIFALSTLISSVQIYNLKENLQEDDLQYLQLFTEYGKLLKNEDGSKAFQMLMFLIRDWPYYYEHAFGAKGGEELLKKRLEITDKMPKELCDLREHIRSCFDKVSCFLMPHPGFKVSNPSYNGNFSELSTEFRNALKELVPSIFAPENLNIKKINGVKVTCADMYTYFQTYMTAFNSDSMITPSSIFENTKRAALMAAIREATSKYTKIMDAACNTDTPSMPGEGVRVTHNQALAKAIEAFNKKGKMGSQKEIGAYLTQLKRDLEDQLPRYGLMNDGKYRKLAFEAKEVFDNTVKAVHGENLFCLHPNDVEPLFNEAVLAASTYFDSKRQKIPNVIDEEKNKFIQYLGKELKCLQALNLQNNRHVITELKMNFSSFMEGLVNKEPPLDDNEYEAKYQESYRKAIETFDQRRNRPTEFPEDVFKLSLMQHMAAQFINLQAINRSKNRKQFMMALSFYTNHMSLFWDPDTCCLHPNDLANEHKLASEQALKLFHPELPDEMEREILKQFIKSKYDDLRELNDAANETAIATAVNVYVEKMEKATEFKGWWIPTLGIPYLVNLANRSSYHEEAKEAALLNFYSNRRDRMNSAPDKYYNELIKGLGEIRLPGPRSKAAGLCVSHAPRRLLLQDGALAEVDHRLPRLVVTEHRYHNTRQRQVVSYFCDEDTAPPLPFGAGDKRVLRRVQVTTTMVALCRRLGSDPVQELTEATVPKAVQSLIIYSLLLYRKIGQFEYWRVYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRSALLPGLSVICYADDTLVVARGGSFAESARLATAGAPESATCRCPYRGWRRPYWVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVGGALSWLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRVWGVARPSPSVVRARRAQSRRSVLESWSRRLADPLAGRRTVEAIRSVLVNWAIESNRYIEDLINMSGPRCVQVVNRNENHNYVLEDNALQRILLREDVKDLPLMVVSVVGAYRGGKSFLLNYFLRYLNSPTEKRNENGDWLGNETDPLVGFSWKGGFQRHTTGILMYSEPFITTTATGEKVAVLLMDTPGLFDPNSTVRDSSIIFALSTLISSVQIYNLIGNLQEDDLQWLQVDFNTRLIYPAVVLKTCAPELTPALTRLYRLSYCANRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINVQLLKYLEDRQLISDRQYGFRHSAGDLLVYLTYSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSKWDELNLVQFIPLKTQVYAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLRVLNRTKRYFTPGQRLLLYKAQVRPSVEYCSHLWARAPKYLLLPFDSIQRRAVRIVDNPILTNRLEPLGLWRDFCCLCILYCMFQGEYSEELFEMIPASRFYHRTACHRSRDWFYPYEHAFGAKGGAELLKKKLENTKRAALTAATREATSKYTKIMDSACNTNTPSMPGEGVRVTHNQALDKAIEAFNKKGKLGSQKEIDAYLTQLKRDLEEQLPRYGLMNDGKYRKLAFEAKEVFDNTVKAVHGENLFCLHPNDVEPLFNEAVLAAVTYFDSKRQKIPNVFDEEKIKFIQCLGKELKFLQALNLQNNRHVVTELKMNFSSFMEGLVSKDPPLDDNEYEVKYQESYRKAIETFNQRRNRPTEFPEDVFKLSLMQHMPTQFTDLKEINRSKNRKQFMLSLSFYVNYMSLFWDPDTCCLHPNDLVNERNLALEQALKLFHPELPDDMEREILKQFIKSKYDDLRELNDAANETAIASAVNVYIEKMDKATEFKGWWVPTLGIPYIVNLANRSSYHEEAKKAVLLNFYSNRRDRMNSAPDKYYNELIKEINYARMKY

Summary

Uniprot
ProteinModelPortal
PDB
3X1D     E-value=3.51066e-113,     Score=1051

Ontologies

Topology

Length:
2111
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.50576
Exp number, first 60 AAs:
0.10266
Total prob of N-in:
0.00521
outside
1  -  2111
 
 

Population Genetic Test Statistics

Pi
246.292631
Theta
207.928943
Tajima's D
0.394663
CLR
1.112552
CSRT
0.48287585620719
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 EAALLNFYSNR 100.00 9e-09
24402669 HTSCVTAFIATCHCDSGYIFNSEGK 95.24 2e-08
28467696 HTSCVTAFIATCHCDSGYIFNSEGK 95.24 2e-08
29197581 ENIQEDDIQYIQIFTEYGK 95.24 2e-08
26822097 EIVPSIFAPENINIK 100.00 9e-08
26280517 IIEQQGMIGK 100.00 9e-08
25044914 IMCAGSAPIPSTIFDKWEK 100.00 9e-08
24402669 IMAWFGDNQDR 100.00 9e-08
28467696 IMCAQQCGVVVEIQR 100.00 9e-08
29197581 HTTGIIMYPEPFITTTAAGEK 100.00 9e-08
24402669 EIKQAIIHKPK 95.24 2e-06
25044914 DWNVDIIPK 100.00 5e-04
24402669 DWIFNIMR 100.00 5e-04
28467696 DWNFCSYAIDGTR 100.00 5e-04
28556443 AALMAAIR 100.00 0.004
28556443 MNFSSFMEGLVNK 100.00 0.004
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号