SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02960
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.11
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCATTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTTGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGTTTTCGTGGTGGTCCGTATAGCAGTCTTCGGTGACCACGATAACTATAGAGAATACGAAACGCCATAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPVFVVVRIAVFGDHDNYREYETP

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    ABLF02042518    ABLF02057746    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMR01018716    MBY31335.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GFTR01008038    JAW08388.1    GGMS01002955    MBY72158.1    NEVH01006736    PNF36716.1    ABLF02034467    GGMS01000737    MBY69940.1    GFTR01008262    JAW08164.1    GBBI01004571    JAC14141.1    GEZM01053022    JAV74219.1    ABLF02024246    ABLF02028535    ABLF02028545    GGMS01002992    MBY72195.1    GGMR01003407    MBY16026.1    ABLF02041767    NEVH01022639    PNF18527.1    GFTR01008279    JAW08147.1    NEVH01021205    PNF19912.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GGMR01000676    MBY13295.1    RPOV01000134    RPJ78669.1    GFTR01008151    JAW08275.1    GFXV01007093    MBW18898.1    ABLF02008463    S59870    AAB26437.2    NEVH01016302    PNF25823.1    AF237761    AAF81411.1    GGMR01003864    MBY16483.1    GEZM01084969    JAV60363.1    ABLF02023911    GFTR01008271    JAW08155.1    GFTR01008251    JAW08175.1    AY060438    AAL25477.1    GGFJ01001857    MBW50998.1    NEVH01020940    PNF20481.1    GFTR01008261    JAW08165.1    GGFJ01001858    MBW50999.1    LBMM01013518    KMQ85605.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGMR01016905    MBY29524.1    GFTR01008256    JAW08170.1    GFXV01000908    MBW12713.1    GGMS01017365    MBY86568.1    GGMR01000226    MBY12845.1    GGMR01014053    MBY26672.1    KK119692    KFM76444.1    NEVH01007838    PNF34986.1    GECL01003538    JAP02586.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    NEVH01019964    PNF22161.1    NEVH01026386    PNF14434.1    NEVH01017470    PNF24199.1    NEVH01006754    PNF36554.1    ABLF02014118    ABLF02014121    ABLF02054790    NEVH01006721    PNF37225.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NNAY01003095    OXU19992.1    GGFL01004957    MBW69135.1    GFTR01008257    JAW08169.1    GBBI01001646    JAC17066.1    GFTR01008246    JAW08180.1    GGMS01017914    MBY87117.1    GGFL01005012    MBW69190.1    NWSH01007753    PCG62823.1    GFXV01002840    MBW14645.1    KK119261    KFM75202.1    GGFJ01001822    MBW50963.1    GGMR01000857    MBY13476.1    ABLF02040174    ABLF02040183    ABLF02055266   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
872
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.85935
Exp number, first 60 AAs:
0.04907
Total prob of N-in:
0.04745
outside
1  -  872
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
-1.116913
CLR
416.03989
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号