SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02959
Pre Gene Modal
BGIBMGA003570
Annotation
PREDICTED:_uncharacterized_protein_LOC106110672?_partial_[Papilio_polytes]
Full name
Sodium/hydrogen exchanger      
Location in the cell
Nuclear   Reliability : 2.246
 

Sequence

CDS
ATGGATGAGAAATTAAAACCTATTTTAGAGGAAAATAAATACATAAAACTAAAATTAGAGAACCTGGAAAAGAAAATCGACATTTTAGAGAGAGATAAGAAAACTAACAATATAATAATCCATGGATTGACAGAAGACGAGAAATCGACACCCGAGCTTATCGACAAGGTCAAAGATACAATAACAAAAGAATTAGGCATAGCAATCGAAAATTATGAATTCAACAAAATATATCGTATTGGTAAAACAAACAAAGGTAATCCAACAAAGGTAATCCGACCTATACTGATATGCTTGACTACTGGATGGAAAAAAGCGGAAATATTGAAAAATAAGAGAAAGTTAAAAGCCCTGCATATCACAGAAGATTACTCTAAAGAAACCTTAGAAAAACGTAAGGCTTTACTACCACAACTCATGGAAGAACGGAGAAAAGATATACACATAGCCACTTTTAACGCAAGATCATTAAGAACTCCTGAAAAACTTCAAGAACTTGAATTAGCTTTATCAGATATAAAATGGGATATAATAGGAATAAGTGAAATGAGAAGATATGGAGAAGGAATTGAAGACTATGGAAACTTTATTTTACACTATAAAGGCGAAACCCCAGGGCTCTACGGAGTCGGCTTTCTTGTAAAAAAAGGACTTGCGGAGAAAATAGGAGAAATCAAAGGTGTCTCAGAGAGAATAGCAGTTTTAAACATTGAGTTACCAGTCAAAAATGCTAAAAAATGGTCTATAATTCAAGCTTATTCTCCAACAGAATCGAACAAGAAAGATGACATAAGGAAAATAGAAAAATTCTATGAAGATTTACATCTTACCATTGAAAATTCGCATAAAAATATAATTGTCATGGGTGATTTTAACGGTCAGATAGGAACGTGCAATAACATTGGAGAAGAATACACTATAGGACTGTATGGCTCAGGCAAAAGAACTAATAACGGAGAGAGATTAGTGACTTTTGCCTTACAACATAAACTCAGTATTCTTAATAGTTTTTTCAAAAAGAAGGAAAACAAAAAATGGACATGGACATCCCCAAATGGCATTCATAAAAACGAAATCGATTTTGTCATGTCAAATAATCCTAAGTTTTTCAAGTATGTGTCAATTATCCACAACTTAAATTTCCACTCTGATCATAAAATGGTCCGTGCTGCATTGACTGGGATACCTATGAAAAGGACAAGGAAGTATCATAACAATAATTCAAGGATAGTGTGTACAGGAGAAAGCGAAGCACTCTCAGCTAATCTCAAATTATTGGCAAAGAACCAACACTTCAACAAAGATTTATCCATTGAAGAAAAATACAATAAGTTCATACAAATATTAAAAAAAGCGACAAGAAAGACTAATACAGAAGATAATAGAGCGATTTCAAAACAAACACAGGAACTACTTCAAGAAAGGAAAAACCTCATTAAAGGAAAGGAGGATAAATATAAAATATCAGAAATTAGTAAGAAAATAAATGAACAAATTAGAAAAGATAGAAAAATTAAACGGGACAACACTATGAAAAAACACATAGAGAAGACAGGTGGAATTAAAAAGGCTATAAAAGAACTAACAGTAAAAAAGGACTGGATGCCAAAAGTAAAGACTGACAAAAATAACTACACTTGTAAACGACCAGAAATACTGGAGTTGGCTACAGATTATTACAAGAAACTATATAAAAGCAACAAGAGCGGAAGAGCTCAAATAAATGAACTAGAATCTGTAGGAACTAATATCACACCTACAATTTTGACGGAGGAAACAATGAAAGCAATCAATTCTCAAAAAATAGACAAAACTCCTGGATCTGACCAAATAACCAACGAACTACTAAAATCGGTTGCATCGACCATTGCCCCGATATTGACTGAACTGTTTAATGAAATTATTGAGACTGAAGATATACCCACCGATTGGACAAAATCAACTATAATTTTATTACACAAAAAGGGAGACAAAGGAGACATTGGAAATTATCGCCCAATTAGTTTGATGTCCAATGTGTATAAAATCACATACACGTTGTAA
Protein
MDEKLKPILEENKYIKLKLENLEKKIDILERDKKTNNIIIHGLTEDEKSTPELIDKVKDTITKELGIAIENYEFNKIYRIGKTNKGNPTKVIRPILICLTTGWKKAEILKNKRKLKALHITEDYSKETLEKRKALLPQLMEERRKDIHIATFNARSLRTPEKLQELELALSDIKWDIIGISEMRRYGEGIEDYGNFILHYKGETPGLYGVGFLVKKGLAEKIGEIKGVSERIAVLNIELPVKNAKKWSIIQAYSPTESNKKDDIRKIEKFYEDLHLTIENSHKNIIVMGDFNGQIGTCNNIGEEYTIGLYGSGKRTNNGERLVTFALQHKLSILNSFFKKKENKKWTWTSPNGIHKNEIDFVMSNNPKFFKYVSIIHNLNFHSDHKMVRAALTGIPMKRTRKYHNNNSRIVCTGESEALSANLKLLAKNQHFNKDLSIEEKYNKFIQILKKATRKTNTEDNRAISKQTQELLQERKNLIKGKEDKYKISEISKKINEQIRKDRKIKRDNTMKKHIEKTGGIKKAIKELTVKKDWMPKVKTDKNNYTCKRPEILELATDYYKKLYKSNKSGRAQINELESVGTNITPTILTEETMKAINSQKIDKTPGSDQITNELLKSVASTIAPILTELFNEIIETEDIPTDWTKSTIILLHKKGDKGDIGNYRPISLMSNVYKITYTL

Summary

Similarity
Belongs to the monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family.
Feature
chain  Sodium/hydrogen exchanger
EMBL
ODYU01001637    SOQ38140.1    FJ265564    ADI61832.1    FJ265561    ADI61829.1    + More
FJ265563    ADI61831.1    ODYU01008249    SOQ51673.1    FJ265562    ADI61830.1    KZ149907    PZC78256.1    GBBI01004876    JAC13836.1    FJ265549    ADI61817.1    FJ265544    ADI61812.1    ODYU01004088    SOQ43598.1    FJ265542    ADI61810.1    ACPB03015413    GBGD01000380    JAC88509.1    FJ265550    ADI61818.1    FJ265543    ADI61811.1    FJ265545    ADI61813.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001372    EYC15676.1    JARK01001337    EYC34625.1    JARK01001354    EYC21713.1    GDKW01001596    JAI54999.1    FJ265551    ADI61819.1    JARK01001351    EYC23458.1    JARK01001435    EYC02484.1    JARK01001655    EYB84321.1    GBBI01004877    JAC13835.1    EYC21986.1    GL379892    EGT31981.1    JARK01001473    EYB97806.1    DS268444    EFP01729.1    GL379822    EGT48339.1    AF054983    AAC72298.1    DS268752    EFP01106.1    DS270843    EFO97547.1    DS268591    EFO92565.1    JARK01001348    EYC25050.1    EYC25048.1    QFQQ01000179    PZR20596.1    CAVP010059514    CDL95876.1    EYC25046.1    EYC25049.1    JARK01000314    EYC38488.1    JARK01001340    EYC31464.1    JARK01001347    EYC26034.1    JARK01001393    EYC10025.1    JARK01001349    EYC24520.1    DS268509    EFO83760.1    JARK01001626    EYB85833.1    DS268655    EFO97114.1    EYC30828.1    JARK01000460    EYC36759.1    JARK01001621    EYB86109.1    JARK01001531    EYB92324.1    EYC36749.1    JARK01001647    EYB84687.1    JARK01001395    EYC09730.1    EYC09729.1    JARK01001505    EYB94617.1    EYB94618.1    JARK01001459    EYB99276.1    EYC09727.1    EYB99275.1    EYC09726.1    JARK01000343    EYC38099.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF00069   Pkinase
PF00201   UDPGT
PF04870   Moulting_cycle
PF10328   7TM_GPCR_Srx
PF00999   Na_H_Exchanger
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR027124   Swc5/CFDP2       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR029052   Metallo-depent_PP-like       
IPR017441   Protein_kinase_ATP_BS       
IPR008271   Ser/Thr_kinase_AS       
IPR011009   Kinase-like_dom_sf       
IPR000719   Prot_kinase_dom       
IPR002213   UDP_glucos_trans       
IPR006954   MLT-10-like       
IPR001507   ZP_dom       
IPR019430   7TM_GPCR_serpentine_rcpt_Srx       
IPR017452   GPCR_Rhodpsn_7TM       
IPR029044   Nucleotide-diphossugar_trans       
IPR004835   Chitin_synth       
IPR020846   MFS_dom       
IPR018422   Cation/H_exchanger_CPA1       
IPR006153   Cation/H_exchanger       
IPR004709   NaH_exchanger       
SUPFAM
SSF56219   SSF56219        + More
SSF56112   SSF56112       
SSF53448   SSF53448       
Gene 3D

Ontologies

Topology

Length:
680
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000960000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00016
outside
1  -  680
 
 

Population Genetic Test Statistics

Pi
188.227426
Theta
17.61745
Tajima's D
0.450121
CLR
31.025511
CSRT
0.507474626268687
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号