SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02955
Pre Gene Modal
BGIBMGA003566
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_trypsin?_alkaline_A-like_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.16 Nuclear   Reliability : 1.087 PlasmaMembrane   Reliability : 1.184
 

Sequence

CDS
ATGAATTCTATCATCATTTTGTTGGCCCTTGGTCTGGCTGCTGTGGCAGCTGTTCCAACAAACCCCCAAAGGATTATTGGTGGCTCGACAACCACCATTGACCGGTACCCCGGTATTGTTTCTCTGTTGTTTACAAGGAATTGGAGTCAGTGGTGGCAGAACTGCGGCGGAAACCTTCTTAACCAGAGATCTGTTCTTTCTGCTGCTCATTGCACATTCGGTGATCAAACGGCTGCATGGCGTTTTCGTGTTGGTTCCACCTGGGCCAACAGTGGGGGTGTTGTGCATCTCTTGAACAGAATTATCTATCATCCCAATTATAACAGATTTACAGCTGACAGTGACCTCTGCATCTTACGCAGTTCCACCAACATAGTTTTGAATAACAACGTTCGTCCTGTTAATATTGCTGGTGCCAATTACAATCTTGCTGATAACCAACCTGTTTGGGCTGCTGGTTGGGGTGCTACTTCGCTCGGAGGTTCTGGTTCGGAGCAGCTTCGTCACGTTCAGGTCTGGACTATCAATCAGAATACCTGCGCCCAACGTTACAGACCCATTAACCGTTCTATCACCGCTAACATGTTGTGCTCTGGTGTTTTGGACGTTGGTGGTCGCGACCAGTGCCAGGGTGACTCCGGTGGTCCTCTCCTCCACAACAATGTCCTTGTTGGTGTCTGCTCTTGGGGACAGTACTGCGCTGACCGTCGCTACCCTGGCGTCAACGATACTGCTGAAGCCATAGATATCGTAACATCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATGTTAGGGAACTCCTTAGAGCCAAGAACGCCTCGATCCGTGCCTACGATAGAAGATATGGGTCTAAAAAATTGTTGGATGTTTTATCATCTTTAGGATTTGCTGCATCATATAATAATACCATACAGTATGAAGTTTCAGCAGTTTACCATCCACAACCTCGTATTTTACCATCAGAGTCTGGTGCGTTGGTACAATATGTTGGAGACAATGCAGATATTAATCCCCTGTACTCAAAAGCACGTGAAATGGTTGCTGCGTCAAACTCAGACTTGTCTAAAACAGTTGTCAAACTTGGAGGATTTCATATGCTCATGTCTTTTCTTGGATGCATAGGACATGTAATGGACGGTAGTGGTCTCAAGGAAGCTTTAAGTAAAATATATGCTACAAATTCGGTCGACAAAATGTTGAATGGTCACGCTTATGCAAGAAGTATCAGAGGCCATATATTATTACGACTTGCATTATCAATAAAGATTTTTGAAGAGATGAAAATTGAAAATTGTGTGTTAGATGAGTTAATTGAACAGATAACTAGTCGCGATGTTTCCTACGAAGATGTTGAAGGATGTACGAGCAGCTCCAACTCGTTAATTGATCAATTTCAGGATAAACTAAAAGAATTAAAAGCTCGAGGTCCCACGGCACAGTTATGGGTGCAATATTTTGAAATGGTATCAATAGCCCTAGATTTCATTCGCGCTGAAAGGCTGGGACTTTTCAAGAACATTTGGATGCAGTGCGAAAAATGCTGCCCTATTTTCATGCTGGTGGTCATTTCCTATATGCGAAATAAACTGGTGGAAGTATTTCAACAAGAAAACTGCCCAAAACAAACATTATTAGAAAATGGAGTGCGCATCTTGTTGGCATTATATAATGCTCCAAAATCTGAGGACAACATTGATCATTTCCGCTACACGCAATTCATCAAATTTACAAAACTAAATAAACCTGTACAACTGTCAACACTTCCACCAACAAGTGTAGCAGCTCATCAACACATAAAACGTGTCTACTACCAGATTCAAACGTGGTTAGGGAAGGACTTAGAACCTCAAGAATGGGGCTGGATGCTTGAAAATGAAATCCTGGAGCCCATACGAACGTTATTACCTCCAGCACCAGCCGAACTACTAAACGTAATATTTTGCAATTGCAAAAATGGTTGTGGTTCCCGCTGTGGATGCAGAAAATCAGGGCTACAATGTTCTTTAGCTTGCGGCCAGTGCAACGGACAAGCTTGCCTCAACGCTTCACTGTATCCAAGTAATCCCGATGAAGAAAATACATATGATCCCGATATTCTCGAAGGTTTGGAGATGAACATGACAGATAATGAGGATGATGACAATGAATCGAACATTTTTGAGCGACAAGAAGAAGAAGACAACGAAGAAGAAGAAGATAATTAG
Protein
MNSIIILLALGLAAVAAVPTNPQRIIGGSTTTIDRYPGIVSLLFTRNWSQWWQNCGGNLLNQRSVLSAAHCTFGDQTAAWRFRVGSTWANSGGVVHLLNRIIYHPNYNRFTADSDLCILRSSTNIVLNNNVRPVNIAGANYNLADNQPVWAAGWGATSLGGSGSEQLRHVQVWTINQNTCAQRYRPINRSITANMLCSGVLDVGGRDQCQGDSGGPLLHNNVLVGVCSWGQYCADRRYPGVNDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLPDDVRELLRAKNASIRAYDRRYGSKKLLDVLSSLGFAASYNNTIQYEVSAVYHPQPRILPSESGALVQYVGDNADINPLYSKAREMVAASNSDLSKTVVKLGGFHMLMSFLGCIGHVMDGSGLKEALSKIYATNSVDKMLNGHAYARSIRGHILLRLALSIKIFEEMKIENCVLDELIEQITSRDVSYEDVEGCTSSSNSLIDQFQDKLKELKARGPTAQLWVQYFEMVSIALDFIRAERLGLFKNIWMQCEKCCPIFMLVVISYMRNKLVEVFQQENCPKQTLLENGVRILLALYNAPKSEDNIDHFRYTQFIKFTKLNKPVQLSTLPPTSVAAHQHIKRVYYQIQTWLGKDLEPQEWGWMLENEILEPIRTLLPPAPAELLNVIFCNCKNGCGSRCGCRKSGLQCSLACGQCNGQACLNASLYPSNPDEENTYDPDILEGLEMNMTDNEDDDNESNIFERQEEEDNEEEEDN

Summary

Uniprot
ProteinModelPortal
PDB
2VU8     E-value=1.0158e-33,     Score=362

Ontologies

Topology

SignalP
Position:   1 - 17,         Likelihood:  0.996158
 
 
Length:
751
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.75099000000001
Exp number, first 60 AAs:
3.66097
Total prob of N-in:
0.18027
outside
1  -  751
 
 

Population Genetic Test Statistics

Pi
254.017028
Theta
165.695149
Tajima's D
0.293701
CLR
0.582226
CSRT
0.454127293635318
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号