SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02954
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 3.104
 

Sequence

CDS
ATGGTTGCATTCCATCGGGAGGTGTCAGAGGGCGTAATCCAACTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGGTGACGATTTAGTCACTCCCAGGGAGGTGCGGCCCCTCATCAAGCTGATGAAGAGGCGCAAAGCCCCCAGCGAGGACGGTATTCCCCCCCTCGCCCTACAAAATCTCCCTCCTTCAATTGTGTCAGCAATGACACGATTGTTTAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAACTGGGCAAGATCATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCATTCGTACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAAGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTTCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGCAGAGCCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGAGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACTAATGACATCCCTACACTGGAGGGTCACCTTCGCGCGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCTATTATGAGGATGCAGAGGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGATCAATGTGGGAAAGACCGTGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCCTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGACTCGCGCGGCCAGGTTCTTGTTGCGGCCGGTGCTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAAGACATACGTCCGTTCCCGCCTCACATACGCTGCTGAGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGCAGAGTCTTTCCCTCCGCATTATCGTCGGGGCCGGGCAGTACGTCAGAAATGACGTTATTGCCCGGGACCTAGGTGTAGAGTCGCTCGTGGAGTTTGTGACTAGGCTTGCCCGTAATATGTACGAGCGAGCCGAAAATGGGCCCCATGAGCATCTCCACAACATAGGCCCGCTGCACGCCAGACCACCGGATGGTACGGCGTTGCCGCGGAAGCTATTGGTAACCCCGACGATCATTCGGAGTTAA
Protein
MVAFHREVSEGVIQLLKPESPGVELGGDDLVTPREVRPLIKLMKRRKAPSEDGIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLHSYVGKLFERLLLKRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRAFFVAVEGARSSVRPITAGVPQSSVLSPILYALYTNDIPTLEGHLRAWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDLLPQWLDRWRVAINVGKTVALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVAHVNRVIGQTRAARFLLRPVLASGLPTRTKLAIYKTYVRSRLTYAAEAWYHLLSPSQRSRLQAQQSLSLRIIVGAGQYVRNDVIARDLGVESLVEFVTRLARNMYERAENGPHEHLHNIGPLHARPPDGTALPRKLLVTPTIIRS

Summary

EMBL
NWSH01000895    PCG73652.1    ABLF02055645    GGMR01004661    MBY17280.1    ABLF02017815    + More
ABLF02050434    ABLF02064867    GEZM01074951    JAV64378.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02017813    ABLF02034467    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02033522    ABLF02008463    ABLF02041767    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02023911    GGMS01017914    MBY87117.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    NEVH01000280    PNF43672.1    KK117880    KFM71667.1    NEVH01003017    PNF40781.1    NEVH01005938    PNF38077.1    NEVH01023961    PNF17613.1    NEVH01007443    PNF35684.1    ABLF02028535    ABLF02028545    NEVH01020071    PNF21969.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    NEVH01023962    PNF17612.1    NEVH01001355    PNF42855.1    NEVH01010546    PNF32261.1    NEVH01019964    PNF22161.1    NEVH01014858    PNF27387.1    NEVH01006754    PNF36554.1    NEVH01007838    PNF34986.1    ABLF02066620    ABLF02040650    ABLF02040651    ABLF02056776    NEVH01002716    PNF41415.1    NEVH01019376    PNF22596.1    JXUM01155316    KQ572171    KXJ68070.1    GEZM01008457    JAV94772.1    NEVH01017470    PNF24199.1    NEVH01011985    PNF31054.1    NEVH01019080    PNF22876.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01026154    PNF14491.1    NEVH01021205    PNF19912.1    ABLF02014862    ABLF02014866    ABLF02061908    KK119261    KFM75202.1    AB018558    BAA76304.1    NEVH01023280    PNF18085.1    ABLF02029306    ABLF02029314    ABLF02060138    GALX01005299    JAB63167.1    KQ973342    KXZ75569.1    KK115908    KFM66338.1    KQ971729    KYB24751.1    GBYB01008290    JAG78057.1    ABLF02003961    ABLF02059872    NEVH01002704    PNF41489.1    AB055391    BAB21761.1    NEVH01000269    PNF43694.1    GFTR01008038    JAW08388.1    GGMS01012005    MBY81208.1    GFDL01000004    JAV35041.1    GFDL01000006    JAV35039.1    U07847    AAA17752.1    NEVH01017542    PNF24034.1    NEVH01022639    PNF18527.1    NWSH01000032    PCG80497.1    KK117974    KFM71881.1    GGMS01004685    MBY73888.1    GBBI01004571    JAC14141.1    NEVH01011193    PNF32021.1    GGMS01008766    MBY77969.1    GGMS01000737    MBY69940.1    KQ459259    KPJ02068.1    KK113147    KFM59463.1    KQ459265    KPJ02064.1    GFXV01005866    MBW17671.1    PCG80496.1    GBBI01004395    JAC14317.1    GFTR01008279    JAW08147.1    KK113014    KFM59099.1    GBHO01016496    JAG27108.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    LBMM01010106    KMQ87671.1    GFTR01008262    JAW08164.1    GEZM01101509    JAV52620.1    GGMS01002992    MBY72195.1    KK116089    KFM66762.1    JXUM01014072    KQ560393    KXJ82651.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03184   DDE_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR004875   DDE_SF_endonuclease_dom       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR018289   MULE_transposase_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=5.94378e-05,     Score=112

Ontologies

Topology

Length:
501
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02243
Exp number, first 60 AAs:
0.00108
Total prob of N-in:
0.00222
outside
1  -  501
 
 

Population Genetic Test Statistics

Pi
312.95171
Theta
171.538058
Tajima's D
2.683891
CLR
0.244364
CSRT
0.960801959902005
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号