SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02948
Pre Gene Modal
BGIBMGA005984
Annotation
PREDICTED:_uncharacterized_protein_LOC106720343_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.451
 

Sequence

CDS
ATGGTGAACACTCGAAGTGATAATCGTGCTAGCCGAAATCGCAGGGATGATGATGCAACGGACCCGTCGTCTGTCCGCGTCCCGCGATCGGTCTCCCCGAGCGCGTCCGCCGCCCAAGAAAATGGCGCCGGTGACGCCTCGCGCATAATCTACGAGTCCTTTCGAGAAGCATCTACGAGCGCGTCTCCCGCCTGCGAAATCGGCGCTGCTGACGCCTCGCGCTCCAATCACCACAACCGATCCGGCGACAGCCACGTGGCCCCCGCCGAAGCCACCTTCTCCAGCGAGCACGTGTCAACAATAGTAGAGGCACTACAGCGGAGCCAAACAGAGGTTTTGAAATCATTATTTGAAACGATACGGCACAACACATCAACACCAGTGCCCGCATCACATGCACACGCGAACTTCGCCAGATGTACCGCGCGCTTTAGTGGGACTGCAGGTGAGTCGCTTGATGCCTTCCTGGATGCGGCTGAGGCGTATCGCGACTGCTCCGACATCTCGGATGAGAACGCCGTCCGGGGATTGTCCATGATGTTGTGCGGCGACGCTGCCGTCTGGTGGCTGGGTGTGAAGTTCTCCATATCTTCGTGCCGCCGCGTACGGGAGAGACTTCGCCGCGACGAAGTAAGTTCATTCGACGTGCTCCTGCAAAGAGCGCGCCAAATTGAAGACGCGACGAACGAACTTCGCTACGAGCACGACGCCTCAAAGCCGACGGGAGAATTGGCAAGAAAACCATACGAGTCGACGACCGGCACCGGACGCACCCGCCCTCCACCAGCAGTTGCAGCGCGCACGGCCGCGTGCGCTCCGAGCGGCGCCGCCCCCGGCCACGAGCCCGCGACGCAGCCGCCACTTGTTCCCGGAACGCCGCGTGTATTTGACTCCGTCGAAAGGAAGCGACGCCCGAAATGTTCGTATTGCCATTTCTTCGGTCACGAGAAGAACCAGTGTCGTAAGTTAGATTCAAAACAAGGTGATCAATCTCATACTAACTTATCTAAAAATAAAACTCACTCAAAATCTAGTGAAAGTGAAATTAAAAGTGATCAGTCATTTTATTGTGTCGATTCAAAAGTGTGTTTTAAATTTGAAAACGACAAATCAGTAAAAGACCGTATTCATAGTTCTGATTTAGTGCATGAAACTTGTATACCTATTTTGCCAAATAGTGATGCATGCACTGATACCTACACACATTATAAACAACGGCGAAATCCACAAAATTATAATTTTGCTGCCCGTAATTCAAATCGTTCGCGGTTTAAGGTTACTGATAACAGTGATAATGCCGATCGAGCTCGTATTGATCGCCCAGGTTCTTCTCGAGAAAAGAACCACAATATCACTGCATGCAACACGAAATGCATAACATGTAATCGATCGAGTGACGATCGCAAAAATAATAATAGTCCGAGCGAAAACATTACTCATGTTAACCCTTCAGCCGCCACAACTGAAAATGTTAACTTTTTGGTTGCCGAACCTAAAAAAGATAATTTTTATTTCAACAAAAATAAAGATTTGGATATGTTTTCTGGCGTCGACGGACATCTTTGCCGCAATGCCAATACAAACGGGCAATGTCAAACATTAACCTGCGCGGTCGCAGAGGATTCAAATTTTGTTCATCAAAGATGTCCGGGCGACAGTAATATTTGTATACCATTAGTTGAATATTATTGTGATAAAAACGGGATAAACCCGAATTTTCCGAAATATGGGAATAAGCGTGATGTAATGGGATTTGATTGTTTTTATGGTTGCGGCGGAGATGACGATCTTATGGGACCCCCTATTGGTCGTGACGTACGGCCGATTTTTAACATAAATATACTGGGTTTTGACGGCACCGCTTTAATAGACACAGCTGCAAAACACTGCATCGCGGGTCATACGCTATACGCTCTCCTCCAGCAGAACAACCATCCTCTCCACGTTTCCTCTCAACGAGTCAGACTTGCCGACGGTGTGGTGCGCATTATGGACGTTTTTACCACCACACTCGATGTACGCCTAGAGACGACAATTATTTCCACTCCATTCCTCATATTTCCTGAATCCACCAATAATGAAACGTTATTAGGAATAAATTTTATTACCGCAGCTGGAGTAGTAATCGACTTCAAAGAAGAGGTTTGGTTCTTCAGTGATGATGCGATGGTAAAGTATAATCTGTGTTTCGAACCTAAGTCGCGCAAAGTTTCATGCGCCGCTACAGACATCCTTAGGGATGACGAAGGTACTCACCTTACGCCAGCTGAGCGGCAAGCGCTCGCTGACGTACTGGACAGGCACGCACACATCTTCAGAGCAGGGGGAGGTCCAACTCCGTTTGCTGAGCATCGCATCGAAACAGGTGAGCATGCACCAATTTCAGTACCTCCTTACCGTTTAAATCCTTCGAAGAAACAGCTGATGAAAGAAGAAATAGATAAAATGCTACAGGACGATATAATAGAAGAGTGTGAATCTGCCTGGTGTTCTCCGGCGCTCATGGTACCGAAGTCTAACGGTAAAATTCGTTTTTGCGTCGATTATAGACGCCTCAACACGATAACAAAGGCCGATTCATACCCCATGCCCAGCATAGATGAATTGCTTCAGAGCACGAAGAGAGACTGTTTTATGAGTACGCTTGATCTCCGATCCTCATACTGGCAACTCAACGTTAGGGAGTGCGACAGAGACAAGACTGCCTTTGTCTGTCCGTTGGGTACCTTTCGTTTCAAAAGAATGCCGTTCGGATTGCGCAACGCGCCAGCTACCTTCCAACGACTCATCGATCGTTTGTGTTCCTGCGCCGCGTTACAGGAGGTAACTATTTTAAGGTACTTGGATGATCTGTGTATAATATCTCAAGGGTACCAGCGCCATCTACAGGACCTAGAAACAGTTTTCAATCGTCTTGCGGAATTCAACCTACACCTCAACAGAGAGAAGTGCATTTTCGCAAGACAGAGCGTCAAGTACTTGGGGCATGTCATTACACAAGAAGGCGTTTCTACCGACCCTGAAAAGGTAAGCGCTGTGCTCGAAATGAAAGAGCCGAGTAATCTTAAACACCTCAGGACATTCTTGCAAACATGCTCCTGGTTCCGAAAATTCATTCCAAATTTTTCTAAAGTCGCCGAACCCCTGACACGCCTTACGAGAAAAAACCAAATCTGGATTTGGGGCGCAGAGCAGGTGAGAGCGTTTGAAGAGCTGAAGCGTCTTTTGACCACAGCTCCCATACTAATACAGGCCGACTTTAGCCTCCCCTTCATCCTGCGTACGGATGCAAGTGACTACGCCTTGGGCGCTGTTCTATTACAGGGTGACGGAAATCAGGAGAGGCCAATCGAGTACGCTAGCCGTCTCCTTAATGCGGCTGAGCGAAACTATTCAACCACTGAGCGAGAGGCTCTCGCTGTGGTGTGGGCGGTGGAGCGTTTCCGTTCTTACCTAGACGGTAATCCAGTCATCATAGGCAGCGACCACCAACCCCTCCGATGGCTGCTATCGCTGAAATCACCAACGGGCAGGTTAGTTCGTTGGGCTCTAAAGCTTCAAGCTTTTGACATCCAATTTCAATATACCCCGGGGAAGGCAAACGTCGTGGCCGACACGCTGAGCAGACCGGTATGTTCCGATGAATCCCGCAAAGAGTGCGGTGTCTGTTCGGTTATCTGTGACCTACCCACGAAGTCACCAAGCGAAATTCGTGACGAACAGAAGTCAGATCCGGAAGTGTTCAAGGTAATCAAAGAGATCGAAGGGACCGACGACGTTGCAGTTCAAAGATGGCTCGACAGAGGCTATGTCATGGACCAAGGTGTGTTATACCGCTTTAACCCAGATTCCGATAGCGAGTCACCTCAACTAGTCATCCCTGCAAACCTAATTCCCTCCATAATCGAAGAACTGCACGACTCACCGACGGCTGGCCATCCAGGTATTGATAGAACTTATCAAAAGATTGCGCAATTGTACTATTTCACAGGGATGCGGAGAATAATCACGGATTATGTGCGAGCCTGCATCCACTGCCAACGCTACAAGGCAAACAACGCCAAACCTCCTGGTCTTCTTCAAACGCCCGTTATGAATCAGCGCAACGAGGTGTTGGCCATCGACTTATTCGGCCCGTTGCCAGTCGGAGAACAGGGGGAGCGTTGGGTGTTTCTTGTAGAAGATACCGCAACCCGATGGATAGAGTTATATGCTTTAAAGGAAGCTACATCTGAAGCTTGTGCTCAGCTCCTTATTGAGGAGTATTTCTTGCGATTTGGTCTACCTCGCAGGATTATTTCAGATAATGGAGTCCAGTTTGTCTCCGCGGTGATGCGACAATGTATGTCTGTTTTGAAAATCAAACAGAACTTTGTCCCGTTATACCATCCTGAGGCAAACCCTGCTGAGCGGAAAAATCGAGACCTAAAAGCAATGCTTGCACATCTTGTAGAAGAGGACCACACCTCATGGCCGAAGAAGCTGCCTCTGATCCGCTTTGCTCTGAACGGTGCAAAGTGCCGCACTACAGGTATGTCACCTGCTTATTTATTCTTCGGCAGAGAAATGCGGTCGCCTGTAGAAGTTCAACACGACATTCGTGCTATATTGAATAAAGAAAACTTTGTTCCTCAAATATCACCTTACCTCCGGAACTTCCTAGACTCGTTATCAGCTGTTCGAGAGCGCGTGGAGATACAACAAGATAAAGCAAAGCAGTATGCCGACACTTCGCGCAGACCATCCAACACCTTTCAGGTAGGTGATTTGGTTCTCGTCAAGTCCCACTTTCTCAGCAAAGGATCGAAGGACCTTACTGCCAAGTTTCTTCCACGCCGCGACGGTCCCTATATTATTGCCCAAAAAGTCAGTCCTACGACTTACACAATCGCAACCCCCGAACAGCCTGATATTATATTAGGGAAATACCATACCCAAGACCTTACCTGTTATCACGGTAACAAAGACTCCTTACCCAAACCTGTGATTCCTAAGAGGAAACGTGGACGCCCAGCTAAGGCTGTTGATGTCCTAGTCCAGGAGCGAGGGCGTTCTCCAGGACTAGAGGGGGAGTATATAGCAACCCTAACGCCTGCCGCGTCGGCAGCCGCGTCTGATCGCGCGCCGCGACCAATGAGGGATTCTCGTTGTCGGCTCCCGGCGCGATTCAAAGAGTAG
Protein
MVNTRSDNRASRNRRDDDATDPSSVRVPRSVSPSASAAQENGAGDASRIIYESFREASTSASPACEIGAADASRSNHHNRSGDSHVAPAEATFSSEHVSTIVEALQRSQTEVLKSLFETIRHNTSTPVPASHAHANFARCTARFSGTAGESLDAFLDAAEAYRDCSDISDENAVRGLSMMLCGDAAVWWLGVKFSISSCRRVRERLRRDEVSSFDVLLQRARQIEDATNELRYEHDASKPTGELARKPYESTTGTGRTRPPPAVAARTAACAPSGAAPGHEPATQPPLVPGTPRVFDSVERKRRPKCSYCHFFGHEKNQCRKLDSKQGDQSHTNLSKNKTHSKSSESEIKSDQSFYCVDSKVCFKFENDKSVKDRIHSSDLVHETCIPILPNSDACTDTYTHYKQRRNPQNYNFAARNSNRSRFKVTDNSDNADRARIDRPGSSREKNHNITACNTKCITCNRSSDDRKNNNSPSENITHVNPSAATTENVNFLVAEPKKDNFYFNKNKDLDMFSGVDGHLCRNANTNGQCQTLTCAVAEDSNFVHQRCPGDSNICIPLVEYYCDKNGINPNFPKYGNKRDVMGFDCFYGCGGDDDLMGPPIGRDVRPIFNINILGFDGTALIDTAAKHCIAGHTLYALLQQNNHPLHVSSQRVRLADGVVRIMDVFTTTLDVRLETTIISTPFLIFPESTNNETLLGINFITAAGVVIDFKEEVWFFSDDAMVKYNLCFEPKSRKVSCAATDILRDDEGTHLTPAERQALADVLDRHAHIFRAGGGPTPFAEHRIETGEHAPISVPPYRLNPSKKQLMKEEIDKMLQDDIIEECESAWCSPALMVPKSNGKIRFCVDYRRLNTITKADSYPMPSIDELLQSTKRDCFMSTLDLRSSYWQLNVRECDRDKTAFVCPLGTFRFKRMPFGLRNAPATFQRLIDRLCSCAALQEVTILRYLDDLCIISQGYQRHLQDLETVFNRLAEFNLHLNREKCIFARQSVKYLGHVITQEGVSTDPEKVSAVLEMKEPSNLKHLRTFLQTCSWFRKFIPNFSKVAEPLTRLTRKNQIWIWGAEQVRAFEELKRLLTTAPILIQADFSLPFILRTDASDYALGAVLLQGDGNQERPIEYASRLLNAAERNYSTTEREALAVVWAVERFRSYLDGNPVIIGSDHQPLRWLLSLKSPTGRLVRWALKLQAFDIQFQYTPGKANVVADTLSRPVCSDESRKECGVCSVICDLPTKSPSEIRDEQKSDPEVFKVIKEIEGTDDVAVQRWLDRGYVMDQGVLYRFNPDSDSESPQLVIPANLIPSIIEELHDSPTAGHPGIDRTYQKIAQLYYFTGMRRIITDYVRACIHCQRYKANNAKPPGLLQTPVMNQRNEVLAIDLFGPLPVGEQGERWVFLVEDTATRWIELYALKEATSEACAQLLIEEYFLRFGLPRRIISDNGVQFVSAVMRQCMSVLKIKQNFVPLYHPEANPAERKNRDLKAMLAHLVEEDHTSWPKKLPLIRFALNGAKCRTTGMSPAYLFFGREMRSPVEVQHDIRAILNKENFVPQISPYLRNFLDSLSAVRERVEIQQDKAKQYADTSRRPSNTFQVGDLVLVKSHFLSKGSKDLTAKFLPRRDGPYIIAQKVSPTTYTIATPEQPDIILGKYHTQDLTCYHGNKDSLPKPVIPKRKRGRPAKAVDVLVQERGRSPGLEGEYIATLTPAASAAASDRAPRPMRDSRCRLPARFKE

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=4.10574e-66,     Score=644

Ontologies

Topology

Length:
1725
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.29167
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01455
outside
1  -  1725
 
 

Population Genetic Test Statistics

Pi
408.384017
Theta
181.445264
Tajima's D
3.876899
CLR
0.953989
CSRT
0.998250087495625
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号