SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02931
Pre Gene Modal
BGIBMGA003636
Annotation
PREDICTED:_uncharacterized_protein_LOC107046642_[Diachasma_alloeum]
Location in the cell
Cytoplasmic   Reliability : 1.138 Mitochondrial   Reliability : 1.133 Nuclear   Reliability : 1.566
 

Sequence

CDS
ATGATATTGAACTTAGAACCTAAGTTTGGTATAGAAATAAAAGAAAAGTGGAAGGTGATACCAACTATGATTAAGAATTTAGAATTTGGAATTGGAGCTGTACAGTTGAATGATTGTAACAATGAAGAAAAAGATATTGTTAAGAATAATTTGAGATCTAAAACGATTAATGTAATTTCTAACTATTACAATAAGAATGATAGACTAAATCATAAAGTATTAATCAAAAATTTATATATTACTCGAAAATTTCTAAAAGAGAGACCTGACTTAATAGTTGCAAGAGCGGATAAAGGGAACACAACAGTGATAATGTTAAAAACTGAGTATGAAACTGAAATGAGAAAGATGTTGAATGACAAGGTGACATATAAATTATTGAAAAAGGATCCTACAAATAAATGGCAAAAAGTTGCAAACGGTTTAGTGAACAAGTTAGTAGTAGCAAAAATTGTTGAGGAACAACAAGGTAAACATCTGAAAGCAAAGTATACTGTTGCACCTAGGATTTATGGTTTGAGGAAAACACACAAGGAGACTTGTTGTTTGCGTCCAGTGGTCAGTTGTGTTAATTCCCCGAGTTACAACCTGGCACGGTTCCTACATGAAATACTGACTCCAGTGATTGAGAAGTTTCAATATAATGTAAAGAATTCATTTGACTTCGTGACATTTAGTGAAAAGGTTAGCTTACCGAAGAATTATGTTCTGATTTCATTGGATGTAGTGTCATTGTTCACGAATGTACGTCGTGACTTGATTCTTAAAGTAATTGAGGAAACTTGGGATAACATGAAGCATCTAGTAAAAATTCCTAAGAGTGTGTTAGTTGACCTCATTACGTTTTGTTATGATTCAAGTTACTTTGTATATCAAGGAGAGTTCTATGCACAGATGGAGAGCAGCAGTATGGGAAACCCTGCAAGTCCAGTTATAGCTAACATCGTTATGAACTATGTCATCGATCAGATATTGAAGATTCTACCGTTTGGAATTCACTTCTTAAAGTTGTACGTGGATGATACCATCGCAGCCATACCGGAGTCAGAAGTAAATAATATCTTAGAGTTATTTAATAGCTTTGACAATAATATACAATTTACCATGGAAGTAGAAAAAGATGATAGTTTATCTTTTCTAGACGTGTTAGTCAAAAGATCAAATGATAAATTGATAACTGATTGGTTTGTTAAACCCATTAGTTCAGGTCGGCTATTAAATTGGAATTCAAATCATCCTCGGTCTCAAAAGATAGTGTATCTAAATAATGTTCAAACACATTTAATAACTTACGGAGACCCGTTTCAAAATAATCGAACGGATGTCATTATCTGTATTTCTGGGAATCCTGGAGTACCAGATTTTTATATTGAATTTGCTTCCTATCTACACACAAACACTGGATTACCAGTATGTGTAATAGGACAAGCTGGACATGAGAAAATGCCAGATCAAAAGTCCAACCAATTACAGGGTCAGGAACATTTATTCAATTTGGAAGGTCAAGTGCTTCATAAGTTGGACCTTATCCACAATCACATTGAAAAGAAAAGTAAAATTCATCTAATAGGACATTCTATTGGATGTTGGATGATTTTAGAAATGTTGCAGAAGGATGAACTCATATTACAAAGATTGTCATCTGTGAATTTGCTGTTTCCTACACTACAAAAAATGGCTGAATCAAAAAATGGCAAATTATTGAATAACATTTTACGTCCTCTGCATTATTTCATTTTATTGTTATTCATAATAGTTTATTACTTGCCTGAAAGCATTCGCACATATTTGGCCTTCTCTTACTTAAAGTTAAATTCATTACCCAAACATTTTAGTTCAAGAATATTAAAATTATGTAATCCACGTGTTGGTGAGAAAATATTCCATTTAGCTTACAATGAAATGGATAAGGTAAACTTATTGAACTTTGCAATGATTGATAAAATAAAGCACTTGACGAGGATAATATACAGTAATAGAGATAATTGGGTACCACCACATTGCATGAATGATTTAATGCAATATCAGCCTCTACTAGCCATGAAAGAAGTAGACATTGAACATTCATTTGTTCTAAAATCCTCTGAAGAAGTTGCAGAAATGGCTATTGATTTCATAACTTCTAAAATGTAA
Protein
MILNLEPKFGIEIKEKWKVIPTMIKNLEFGIGAVQLNDCNNEEKDIVKNNLRSKTINVISNYYNKNDRLNHKVLIKNLYITRKFLKERPDLIVARADKGNTTVIMLKTEYETEMRKMLNDKVTYKLLKKDPTNKWQKVANGLVNKLVVAKIVEEQQGKHLKAKYTVAPRIYGLRKTHKETCCLRPVVSCVNSPSYNLARFLHEILTPVIEKFQYNVKNSFDFVTFSEKVSLPKNYVLISLDVVSLFTNVRRDLILKVIEETWDNMKHLVKIPKSVLVDLITFCYDSSYFVYQGEFYAQMESSSMGNPASPVIANIVMNYVIDQILKILPFGIHFLKLYVDDTIAAIPESEVNNILELFNSFDNNIQFTMEVEKDDSLSFLDVLVKRSNDKLITDWFVKPISSGRLLNWNSNHPRSQKIVYLNNVQTHLITYGDPFQNNRTDVIICISGNPGVPDFYIEFASYLHTNTGLPVCVIGQAGHEKMPDQKSNQLQGQEHLFNLEGQVLHKLDLIHNHIEKKSKIHLIGHSIGCWMILEMLQKDELILQRLSSVNLLFPTLQKMAESKNGKLLNNILRPLHYFILLLFIIVYYLPESIRTYLAFSYLKLNSLPKHFSSRILKLCNPRVGEKIFHLAYNEMDKVNLLNFAMIDKIKHLTRIIYSNRDNWVPPHCMNDLMQYQPLLAMKEVDIEHSFVLKSSEEVAEMAIDFITSKM

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
710
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
18.21663
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00272
outside
1  -  710
 
 

Population Genetic Test Statistics

Pi
215.969334
Theta
172.826272
Tajima's D
0.803303
CLR
0.515252
CSRT
0.601269936503175
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号