Gene

KWMTBOMO02894  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA003652

Annotation

PREDICTED:_lamin-C-like_[Amyelois_transitella]

Location

Bomo_Chr5(-):13288400-13297858      View in EpiBrowser

Full name

Lamin Dm0       + More
Lamin-C      

Alternative Name

pG-IF

Location in the cell

Nuclear   Reliability : 3.534

CDS

ATGTATCCCACTAAGTATACAAAAACAAGAAAAACTGTAACATCTTCATCAAATGCTAGTGTTGTGTCATCAGAGCAAAGCCCGCTACAATCTAGCACTCCTGTAGGAAGCCGCCCTTCTAGTTCTGCCGGTCGTCCAAGCAGTCCACTTAGTCCTACCAGGCAAAGCCGTTTGCAAGAGAAAGATGCATTACAAAATCTCAACGACAGGTTGGCTGCCTATATCGATAAAGTACGCCAGTTGGAGAGTGAGAATTCGGGATTACGTCGTGAAATACAAACCACACAGGAGGTGGTCACCCGCGAGGTTTCCAACATTAAAGGAATGTACGAGCATGAACTCCAAGATGCCAGGAAACTGTTAGATGATACATCTCGAGAGAAAGCTAAACTTGAAATTGATTTGAAGAGATTGTACGAAGAGAACGACGACCTGAAGAAGCGCCTAGACAAGAAGACAAAAGACTGCACTCAAGCAGAGAATTTGGCGCGTCACTACGAGACTCGTTTCACTGAGGAAAGCAACAAATACAATACTGCCCTTGCTGATAAGAAGAAAGCGCAAGATGAGGCAAAGGACCTCGCCAAGGAGTTGGAGAAGCTGCGTAAATTATATGCTGATACCCGTAAGACTTTGGAAGAGGAGATGCTCTGTCGCATTGATATGGAAAATACGGTGCAAAGTCTCAGAGAGGAGCTTTCCTTCAAAGACCAGGTGTTCCAACAGGAGCTGCAGGAGACTCGCACTCGTCGTCAAGTGGAAATCTCTGAGATCGATGGTCGCCTCGCTCAACAATATGAGGCCAAACTACAGCAGAGTCTACAGGAATTACGCGAACAACAGGAGGCAAACATCAAGGCGAATCGCGAAGAAATCGAAGCGCTTTATGAAAATAAGTTGAAGAATCTCCAGAATGCAGCTAGCCGCAACAGCAACGCTGCAACAGTGGCCGTCGAGGAACTGCGCACAATGCGCACTCGCATCGATTCCCTCAACTCTCAGCTGAATGATTTAGAGAACAAAAATGCTGCTCTTAGCGTGAGTATACCTGAACTAGCATTGAACCGTCCTATGCTATGA

Protein

MYPTKYTKTRKTVTSSSNASVVSSEQSPLQSSTPVGSRPSSSAGRPSSPLSPTRQSRLQEKDALQNLNDRLAAYIDKVRQLESENSGLRREIQTTQEVVTREVSNIKGMYEHELQDARKLLDDTSREKAKLEIDLKRLYEENDDLKKRLDKKTKDCTQAENLARHYETRFTEESNKYNTALADKKKAQDEAKDLAKELEKLRKLYADTRKTLEEEMLCRIDMENTVQSLREELSFKDQVFQQELQETRTRRQVEISEIDGRLAQQYEAKLQQSLQELREQQEANIKANREEIEALYENKLKNLQNAASRNSNAATVAVEELRTMRTRIDSLNSQLNDLENKNAALSVSIPELALNRPML

Description

Lamins are components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner nuclear membrane, which is thought to provide a framework for the nuclear envelope and may also interact with chromatin (PubMed:3126192, PubMed:15035436). May have a role in the localization of the LEM domain proteins Ote, bocks and MAN1 to the nuclear membrane (PubMed:15035436, PubMed:16439308). In spermatocytes, plays a role in maintaining type-A lamin LamC nuclear localization; regulates meiotic cytokinesis by maintaining the structure of the spindle envelope, and by contributing to the formation of the contractile ring and central spindle (PubMed:27402967).
Lamins are components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner nuclear membrane, which is thought to provide a framework for the nuclear envelope and may also interact with chromatin (By similarity). In spermatocytes, regulates cytokinesis during meiosis (PubMed:27402967).

Subunit

Interacts directly with LBR (PubMed:15054108). Interacts with MAN1 (PubMed:16439308). Interacts with Ote (PubMed:9632815, PubMed:22751930).
Interacts with MAN1.

Similarity

Belongs to the intermediate filament family.

Keywords

Acetylation   Coiled coil   Complete proteome   Cytoplasm   Cytoskeleton   Intermediate filament   Lipoprotein   Membrane   Methylation   Nucleus   Phosphoprotein   Prenylation   Reference proteome  

Feature

chain  Lamin Dm0
propeptide  Removed in mature form

Uniprot

H9J2B5   A0A0P0IVE9   A0A2H1V9Y5   A0A212ELM3   A0A2A4J2M9   S4PXW2   + More
A0A2W1BMT6   A0A194PNK2   A0A0N0PDR8   A0A0C9PKT8   A0A0C9R470   A0A0C9R9V0   A0A1I8NUZ7   T1PG08   A0A1A9X0Q9   E2AVV9   A0A067R8L2   K7ISC5   A0A1B0A5V1   A0A0L0CD77   A0A2A3EM64   A0A2J7Q3M4   A0A088AD32   A0A034VUV3   A0A0J7KKM5   A0A0K8V002   A0A336LYN6   W8B4Q8   A0A0M8ZSD0   A0A1W4WZ32   A0A0A1XLP3   A0A195ES10   A0A158NSD7   V5GWB7   F4W5M2   A0A1L8DX61   A0A151HYG0   A0A151WLV6   E2C4M7   U4UCY7   A0A1J1IIJ6   N6U8V8   D3TNH4   A0A1B0AS75   A0A1A9Y0C9   A0A1A9VH32   B4JAF2   A0A0K8VAY7   A0A0K8W7C1   A0A2P8Z8P6   A0A0K8U6W5   A0A034WNY2   A0A034WSV2   B4P054   A0A0A1WZJ8   W8B5D8   A0A0A1WU36   B3N4X3   B4P773   B3NR30   A0A1W4UIW1   A0A0Q5VNL2   A0A0R1DQL5   M9NE89   P08928   D2A5Q1   B4LU12   B3MMZ6   B4MRK2   B4I1H3   A0A0J9QX72   A0A1Y1MSJ2   A0A0Q9X1P8   T1PGV6   A0A1I8MT33   A0A1I8MT32   A0A0M4EH00   A0A0L0BY01   B4N7B2   B3MII2   A0A1A9WHW3   B4GAV4   Q291D6   A0A0P8Y4R1   A0A1I8PIF3   A0A1W4UHE3   A0A0J9RCU6   A0A0R3NLV9   A0A1I8PI85   Q03427   A0A0M4EVT0   A0A1W4U5U1   A0A0B4KFY9   A0A1A9ZXD8   A0A1A9VDJ4   A0A0J9U1Z9   B4KP06   B4QFV5   A0A1B0G7F5  

Pubmed

19121390    27164127    22118469    23622113    28756777    26354079    + More
25315136    20798317    24845553    20075255    26108605    25348373    24495485    25830018    21347285    21719571    23537049    20353571    17994087    29403074    17550304    10731132    12537568    12537572    12537573    12537574    16110336    17569856    17569867    26109357    26109356    3126192    2123469    12537569    7593280    8999964    9199347    9632815    15035436    15054108    16439308    18723885    18327897    22751930    27402967    18362917    19820115    22936249    28004739    15632085    8314904    8082654   

EMBL

BABH01007612    KT318393    ALK01985.1    ODYU01001433    SOQ37611.1    AGBW02014037    + More
OWR42369.1    NWSH01003681    PCG65938.1    GAIX01004343    JAA88217.1    KZ149960    PZC76369.1    KQ459597    KPI95011.1    KQ460226    KPJ16419.1    GBYB01001618    JAG71385.1    GBYB01001616    JAG71383.1    GBYB01009717    JAG79484.1    KA647080    AFP61709.1    GL443213    EFN62381.1    KK852632    KDR19813.1    JRES01000668    KNC29414.1    KZ288220    PBC32131.1    NEVH01019066    PNF23170.1    GAKP01013065    JAC45887.1    LBMM01006237    KMQ90784.1    GDHF01020087    GDHF01011428    GDHF01010988    JAI32227.1    JAI40886.1    JAI41326.1    UFQS01000212    UFQT01000212    SSX01393.1    SSX21773.1    GAMC01018269    JAB88286.1    KQ435878    KOX69977.1    GBXI01017213    GBXI01005197    GBXI01002789    JAC97078.1    JAD09095.1    JAD11503.1    KQ981993    KYN31040.1    ADTU01024851    ADTU01024852    ADTU01024853    GALX01003938    JAB64528.1    GL887655    EGI70519.1    GFDF01003034    JAV11050.1    KQ976730    KYM76484.1    KQ982956    KYQ48797.1    GL452536    EFN77107.1    KB632003    ERL87810.1    CVRI01000054    CRL00024.1    APGK01044203    APGK01044204    KB741021    ENN75032.1    EZ422976    ADD19252.1    JXJN01002686    CH916368    EDW03823.1    GDHF01016205    JAI36109.1    GDHF01005574    JAI46740.1    PYGN01000145    PSN52874.1    GDHF01030018    JAI22296.1    GAKP01001706    JAC57246.1    GAKP01001707    JAC57245.1    CM000157    EDW88919.1    GBXI01009793    JAD04499.1    GAMC01010200    JAB96355.1    GBXI01012364    JAD01928.1    CH954177    EDV57875.1    CM000158    EDW91038.1    CH954179    EDV56019.2    KQS62612.1    KRJ99583.1    AE014134    AFH03566.1    AFH03567.1    AHN54144.1    X07278    X16275    BT001506    KQ971345    EFA05043.1    CH940649    EDW65065.1    CH902620    EDV31021.1    CH963850    EDW74741.1    CH480820    EDW54380.1    CM002910    KMY88314.1    KMY88315.1    GEZM01022804    JAV88663.1    KRF98124.1    KA647118    AFP61747.1    CP012523    ALC40117.1    JRES01001167    KNC24895.1    CH964182    EDW80253.1    CH902619    EDV37030.1    CH479181    EDW32056.1    CM000071    EAL25176.1    KPU76571.1    CM002911    KMY93791.1    KRT01950.1    L07933    X75886    AE013599    AY095046    CP012524    ALC41782.1    AGB93506.1    KMY93790.1    CH933808    EDW10072.1    CM000362    EDX07100.1    CCAG010019064   

Proteomes

UP000005204    UP000007151    UP000218220    UP000053268    UP000053240    UP000095300    + More
UP000095301    UP000091820    UP000000311    UP000027135    UP000002358    UP000092445    UP000037069    UP000242457    UP000235965    UP000005203    UP000036403    UP000053105    UP000192223    UP000078541    UP000005205    UP000007755    UP000078540    UP000075809    UP000008237    UP000030742    UP000183832    UP000019118    UP000092460    UP000092443    UP000078200    UP000001070    UP000245037    UP000002282    UP000008711    UP000192221    UP000000803    UP000007266    UP000008792    UP000007801    UP000007798    UP000001292    UP000092553    UP000008744    UP000001819    UP000009192    UP000000304    UP000092444   

PRIDE

H9J2B5    M9NE89    P08928    Q03427   

Pfam

PF00038   Filament        + More
PF00932   LTD
PF00561   Abhydrolase_1
PF00052   Laminin_B
PF00055   Laminin_N
PF00053   Laminin_EGF

Interpro

IPR001322   Lamin_tail_dom        + More
IPR018039   IF_conserved       
IPR039008   IF_rod_dom       
IPR042180   IF_rod_dom_coil1B       
IPR036415   Lamin_tail_dom_sf       
IPR029058   AB_hydrolase       
IPR000073   AB_hydrolase_1       
IPR038684   Laminin_N_sf       
IPR000034   Laminin_IV       
IPR002049   Laminin_EGF       
IPR008211   Laminin_N       
IPR000742   EGF-like_dom       

SUPFAM

SSF74853   SSF74853        + More
SSF53474   SSF53474       

Gene 3D

1.20.5.1160     2.60.40.1260     3.40.50.1820     2.60.120.1490    

ProteinModelPortal

H9J2B5   A0A0P0IVE9   A0A2H1V9Y5   A0A212ELM3   A0A2A4J2M9   S4PXW2   + More
A0A2W1BMT6   A0A194PNK2   A0A0N0PDR8   A0A0C9PKT8   A0A0C9R470   A0A0C9R9V0   A0A1I8NUZ7   T1PG08   A0A1A9X0Q9   E2AVV9   A0A067R8L2   K7ISC5   A0A1B0A5V1   A0A0L0CD77   A0A2A3EM64   A0A2J7Q3M4   A0A088AD32   A0A034VUV3   A0A0J7KKM5   A0A0K8V002   A0A336LYN6   W8B4Q8   A0A0M8ZSD0   A0A1W4WZ32   A0A0A1XLP3   A0A195ES10   A0A158NSD7   V5GWB7   F4W5M2   A0A1L8DX61   A0A151HYG0   A0A151WLV6   E2C4M7   U4UCY7   A0A1J1IIJ6   N6U8V8   D3TNH4   A0A1B0AS75   A0A1A9Y0C9   A0A1A9VH32   B4JAF2   A0A0K8VAY7   A0A0K8W7C1   A0A2P8Z8P6   A0A0K8U6W5   A0A034WNY2   A0A034WSV2   B4P054   A0A0A1WZJ8   W8B5D8   A0A0A1WU36   B3N4X3   B4P773   B3NR30   A0A1W4UIW1   A0A0Q5VNL2   A0A0R1DQL5   M9NE89   P08928   D2A5Q1   B4LU12   B3MMZ6   B4MRK2   B4I1H3   A0A0J9QX72   A0A1Y1MSJ2   A0A0Q9X1P8   T1PGV6   A0A1I8MT33   A0A1I8MT32   A0A0M4EH00   A0A0L0BY01   B4N7B2   B3MII2   A0A1A9WHW3   B4GAV4   Q291D6   A0A0P8Y4R1   A0A1I8PIF3   A0A1W4UHE3   A0A0J9RCU6   A0A0R3NLV9   A0A1I8PI85   Q03427   A0A0M4EVT0   A0A1W4U5U1   A0A0B4KFY9   A0A1A9ZXD8   A0A1A9VDJ4   A0A0J9U1Z9   B4KP06   B4QFV5   A0A1B0G7F5  

PDB

3SSU     E-value=0.00257266,     Score=96

KEGG

101743323    K07611 lamin B | (RefSeq) lamin-C-like

PATHWAY

04214    Apoptosis - fly - Bombyx mori (domestic silkworm)

GO

GO:0005882   GO:0005198   GO:0016021   GO:0005641   GO:0007430   GO:0070732   GO:0070870   GO:0007417   GO:0048546   GO:0001745   GO:0035262   GO:0007569   GO:0040003   GO:0005102   GO:0030838   GO:0016020   GO:0008285   GO:0005638   GO:0003682   GO:0007112   GO:0007110   GO:0048137   GO:0050777   GO:0071763   GO:0090435   GO:1900182   GO:1905832   GO:2000433   GO:0005200   GO:0031081   GO:0007097   GO:0008344   GO:0007084   GO:0005637   GO:0005635   GO:0000922   GO:0006342   GO:0005634   GO:0005737   GO:0006998   GO:0005652   GO:0007283   GO:0006997   GO:0006325   GO:0030833   GO:0035989   GO:0060415   GO:0034399   GO:0006468   GO:0007169   GO:0004713   GO:0006281   GO:0048384  

Subcellular location

Nucleus   Nuclear periphery (PubMed:7593280). At metaphase and anaphase, weakly expressed in the nuclear envelope and spindle poles (PubMed:16439308). Expression in oocyte cytoplasm increases after stages 6 to 7 of egg development (PubMed:9199347). In spermatocytes detected at the spindle envelope, spindle poles and astral membrane throughout meiosis I, whereas mostly depleted in meiosis II (PubMed:27402967). Colocalizes with nuclear pore complex component Nup107 throughout meiosis I (PubMed:27402967).   With evidence from 7 publications.
Nucleus inner membrane   Nuclear periphery (PubMed:7593280). At metaphase and anaphase, weakly expressed in the nuclear envelope and spindle poles (PubMed:16439308). Expression in oocyte cytoplasm increases after stages 6 to 7 of egg development (PubMed:9199347). In spermatocytes detected at the spindle envelope, spindle poles and astral membrane throughout meiosis I, whereas mostly depleted in meiosis II (PubMed:27402967). Colocalizes with nuclear pore complex component Nup107 throughout meiosis I (PubMed:27402967).   With evidence from 7 publications.
Nucleus envelope   Nuclear periphery (PubMed:7593280). At metaphase and anaphase, weakly expressed in the nuclear envelope and spindle poles (PubMed:16439308). Expression in oocyte cytoplasm increases after stages 6 to 7 of egg development (PubMed:9199347). In spermatocytes detected at the spindle envelope, spindle poles and astral membrane throughout meiosis I, whereas mostly depleted in meiosis II (PubMed:27402967). Colocalizes with nuclear pore complex component Nup107 throughout meiosis I (PubMed:27402967).   With evidence from 7 publications.
Nucleus lamina   Nuclear periphery (PubMed:7593280). At metaphase and anaphase, weakly expressed in the nuclear envelope and spindle poles (PubMed:16439308). Expression in oocyte cytoplasm increases after stages 6 to 7 of egg development (PubMed:9199347). In spermatocytes detected at the spindle envelope, spindle poles and astral membrane throughout meiosis I, whereas mostly depleted in meiosis II (PubMed:27402967). Colocalizes with nuclear pore complex component Nup107 throughout meiosis I (PubMed:27402967).   With evidence from 7 publications.
Cytoplasm   Nuclear periphery (PubMed:7593280). At metaphase and anaphase, weakly expressed in the nuclear envelope and spindle poles (PubMed:16439308). Expression in oocyte cytoplasm increases after stages 6 to 7 of egg development (PubMed:9199347). In spermatocytes detected at the spindle envelope, spindle poles and astral membrane throughout meiosis I, whereas mostly depleted in meiosis II (PubMed:27402967). Colocalizes with nuclear pore complex component Nup107 throughout meiosis I (PubMed:27402967).   With evidence from 7 publications.
Cytoskeleton   Nuclear periphery (PubMed:7593280). At metaphase and anaphase, weakly expressed in the nuclear envelope and spindle poles (PubMed:16439308). Expression in oocyte cytoplasm increases after stages 6 to 7 of egg development (PubMed:9199347). In spermatocytes detected at the spindle envelope, spindle poles and astral membrane throughout meiosis I, whereas mostly depleted in meiosis II (PubMed:27402967). Colocalizes with nuclear pore complex component Nup107 throughout meiosis I (PubMed:27402967).   With evidence from 7 publications.
Spindle pole   Nuclear periphery (PubMed:7593280). At metaphase and anaphase, weakly expressed in the nuclear envelope and spindle poles (PubMed:16439308). Expression in oocyte cytoplasm increases after stages 6 to 7 of egg development (PubMed:9199347). In spermatocytes detected at the spindle envelope, spindle poles and astral membrane throughout meiosis I, whereas mostly depleted in meiosis II (PubMed:27402967). Colocalizes with nuclear pore complex component Nup107 throughout meiosis I (PubMed:27402967).   With evidence from 7 publications.

Length:

359

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0

Exp number, first 60 AAs:

0

Total prob of N-in:

0.13051

outside

1  -  359

 

 

Pi

246.956645

Theta

191.75984

Tajima's D

1.329825

CLR

0.882491

CSRT

0.749062546872656

Interpretation

Uncertain