SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02872
Pre Gene Modal
BGIBMGA003532
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.947
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGACCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGCTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAAGTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCTGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGACAAACAGATTCGCCAGAGTACATTGGATAAACTATGGAATAAACAGTCTGGTGGGATTCAGATGCTTCTCTCTATTTTGGAATCTTCAAGAGACACGCCAACTTCGACCTACGTAACGGCTATTTTGAGGGAGACGCTATGCTTGAAACAAGGGAAAGGAAAGAAGTGTGCAGTTAGTGAATCCGGAAACAAGAAGAAGGAAACCAAAAAGATTGGGAAGGAAAATAAGTTTGGTTTAGTCAAGAAGGCAAATAACCTCGCCCGGCAGCAGTGTGCTCAGCAGTTCATATCCGCGAACGGTACTCAAGTTATCATTCGTACATTATTAGCGACGCACGGTAAACGAGATGGAAATGTTGGCACCGAGCTAATGCTGCAAGATCTTGTGTGGATCCTCGCGGCACTCGCGCCAAAAGATCCGAAATTCGCAATGAAAATTAGAATGCTGGGATGCGTCAGGACTTTACATCTAATACTAAAAGGACATTTTACTGACAACAAACTCGTTTTTCCCCTTTTGGTAATAATGAAACAACTAGCCAAAAACGAGGTGTGCTGCATGCAGATCGTGAAGACAGGCCTGTGTAGCGTCCTCCTAAGGGTGTTCGATCGATGGGATCGATACGAAGGTCGAATGAGACTGAAGATATGCGCCCACATACTACAGACGCTACAACATCTGTGTAACATCAAGGCAGGTCGTCGAGCTCTGTGCACTAAGAAACATGTTCAAGCGCTGCACAGGTTCTGTTCGCAATGTCCCGATGAACCGGAGTTTGACGGTCTCCTTGCGAGAGTGTGTTCAGTGATTACTTTATGTCTAAAGCATCAAGCTTTACCAGTAGCTGCCGCTAGTCCGGCTACGTTCAACCTGAATCCAATTTTAAAAGGTACAAATGCATCGTGGCCATGTCACGAAGACGAGGAAGACGCTGCTAATTCGGATTCCAAAACAGTTAACTCAGATGACGAAGACAGCCCGGATATTGACATCGATGCTATAGACGAATTTCCTGACATAGAATATGATGATGATACAAAAAATGAAAGTATGGAAGTATTGGATAAGATTAATATTAAAAATGGTGATAGTTTGCAAAGCGCCTTATGGATTAATCCTAATGAGAGAGATTTTGAAGACTTAAAAAAGTATTTTATATTCTTCAAAGAATTTGGTTCCTATAATAAGCAAGCCAAACTCGTTAAAAGCCGGTCCAATTCCCGCGGATCTATTTTAGAAGACTTCTTAATCAACCAAACCTGTTGCAATAGGAACGTTTCCTCTGCACTAAGCCTCTCAATATCTACAGTTTTGGGAACAACATTTGACAACGTATTGACAACATCTCAATTACCTACCTTCACGCAAAGCTTCAATAAGATTCATGAGGTTACTTCGACAACATCTTGTTCTACTTTGAAGATCCATAAAGACATTTCCAAATATAGTTCGTTTGCCTCAGTATATTGTACAATATCCTCAAGAGTGAAGAGTGTAATACCGTTTGTGAAGGTTGCGTATCCCGACATGACAAGGGGACTGAGCATCACGCACCCAGAGCCTTTGAATAAAATGGAAAGGACAGCTTGCAGAGCTAAATTATTATCATGTGTGGACCGAGCAATAAACCCTGAAGCGTATATGAATGAAGTAGTTTATGATTTAGACCAGCTTTGTAGCTCAACAAATAATGTCGATGCAGCCGCACAAAAAAGTTGCGAAGGTTTATTACTGAGTAATAATGATGAACAAGAAATAACGAAAGTCAACAATTTCTCTTCTCGATTAAGCTTTGAATCGAGATTTGAATCTGGAAACCTCAGGAAAGCCATTCAAATAGGCCCCAGAGAGTATGAGCTCGTGCTCATGCCGGACGTTAACTCCAATAAAAGACACCAGTGGTTCTATTTTGAAGTACGTAGCATGCAACAGGGAAGACCGTATATATTCAACATCATCAACTGTGAAAAGTCTGACAGCCAATTCAATTTTGGAATGAAGCCAGTTATTTATTCAGTGAAAGAAGCTGTTTTGGGTCGACCAGGTTGGACGCGAGCAGGATCAGATATTTGTTACTACCGGAACAGCTACCACTACGCGAACCAAAAGAACCACAACAAGTGCTACCTGACTGTCACGTTCAACATTGAGTTTCCACATTCCAATGACGTCTGCTACATCGCTTACCACTACCCCTTCACTTATTCAATGATAATGACTCGTATTTGGCAATGGAGCCTGCAGATGCCTCCCGGTTCGTATTTCCGCGCTGAGCCTCTATGCTACTCTTTGAACAGTAACGAAGTACCCCTTTTAACTGTATCTGCCGAGGACACGCCATCTAATCCAATAGCGGATCGTGAAATAGTATTTCTATCCGCTCGTGTCCACCCTGGCGAGAGCAATGCTTCTTGGGTGATGGACGGCACGCTGGGTTGTCTGCTCGGTGACTCTGTGGTCGCGGCTGCGTTGCGGAGCAAATACGTGTTCAAGATTGTACCGATGCTTAACGTCGAAGGGGTACTCAACGGATGGTAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKTVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPLNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVSMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPDKQIRQSTLDKLWNKQSGGIQMLLSILESSRDTPTSTYVTAILRETLCLKQGKGKKCAVSESGNKKKETKKIGKENKFGLVKKANNLARQQCAQQFISANGTQVIIRTLLATHGKRDGNVGTELMLQDLVWILAALAPKDPKFAMKIRMLGCVRTLHLILKGHFTDNKLVFPLLVIMKQLAKNEVCCMQIVKTGLCSVLLRVFDRWDRYEGRMRLKICAHILQTLQHLCNIKAGRRALCTKKHVQALHRFCSQCPDEPEFDGLLARVCSVITLCLKHQALPVAAASPATFNLNPILKGTNASWPCHEDEEDAANSDSKTVNSDDEDSPDIDIDAIDEFPDIEYDDDTKNESMEVLDKINIKNGDSLQSALWINPNERDFEDLKKYFIFFKEFGSYNKQAKLVKSRSNSRGSILEDFLINQTCCNRNVSSALSLSISTVLGTTFDNVLTTSQLPTFTQSFNKIHEVTSTTSCSTLKIHKDISKYSSFASVYCTISSRVKSVIPFVKVAYPDMTRGLSITHPEPLNKMERTACRAKLLSCVDRAINPEAYMNEVVYDLDQLCSSTNNVDAAAQKSCEGLLLSNNDEQEITKVNNFSSRLSFESRFESGNLRKAIQIGPREYELVLMPDVNSNKRHQWFYFEVRSMQQGRPYIFNIINCEKSDSQFNFGMKPVIYSVKEAVLGRPGWTRAGSDICYYRNSYHYANQKNHNKCYLTVTFNIEFPHSNDVCYIAYHYPFTYSMIMTRIWQWSLQMPPGSYFRAEPLCYSLNSNEVPLLTVSAEDTPSNPIADREIVFLSARVHPGESNASWVMDGTLGCLLGDSVVAAALRSKYVFKIVPMLNVEGVLNGW

Summary

Uniprot
ProteinModelPortal
PDB
3L2N     E-value=2.13013e-09,     Score=155

Ontologies

Topology

Length:
1730
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.46415
Exp number, first 60 AAs:
0.03934
Total prob of N-in:
0.03202
outside
1  -  1730
 
 

Population Genetic Test Statistics

Pi
214.202484
Theta
182.140219
Tajima's D
0.52482
CLR
0.670262
CSRT
0.52272386380681
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号