SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02866
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Mitochondrial   Reliability : 1.153 PlasmaMembrane   Reliability : 1.03
 

Sequence

CDS
ATGGACGCGGTCTTGCGCGTCCGCCACCTCTCCGATCGTGCGTGCTCCGAGGGGGGCGTGTTATTGGCTGTGTCGATTGATATCGCCAACGCCTTCAACACGATCCCTTGGAGCACGATCGTGGAATCGCTCCGGTTTCACCGCGTCCCCCCTAGTCTCCGCACCCTGATAGAGGATTACCTCTCAGGGCGAAATGTGGTCTTCCCCGAGAGGAGGGGGTGGGGACGGAAAGCGGTGTCGTGCGGGGTCCCGCAGGGGTCGGTACTTGGACCACTCCTGTGGGACATCGGTTTCGACTGGGTATTGCGCGGTGCTAGCCTGCGTGGCGTCGACGTAGTGTGCTATGTCGACGACACGCTGGTGACGGCCCGCGGAGCTGACTACAGAGCCGCAGCGATCCTTGCGACGGCGGCGGTCTCCACCGTCGTTAGTCGCATTCGGAGATTAGGTCTTGAGGTGGCCCTCCGCAAGTCCGAAGCGGTGTGCTTTCACCCAGTCCGGAGGGGACCTCCTCCGGGAGCGAATCTCATAGTCGGCGGAGTATCGATCGCTGTCCAGCCGAAGCTCAAATATTTGGGCCTTGTGCTGGACAGTCGATGGCGCTTCGACCACCACTTTGGTGAGTTAGTCCCGAAGCTGCTGGGGATGGCGGGTGCACTAGCCCGTCTTCTCCCCAACGTCGGTGGTTGCAGCGCCGGCGTCCGGCGTCTGTACCTGGGGGTCGTGCGCAGTATGGCTTTGTACGGCGCTCCCGTGTGGTCGCCCGCACTCTCTGCGCGCAATGCAGCTTTACTGCTACGAGCGCAGCAGGTGCTCGCGGTGAGGGTCATCAGGGGGTACCGTACGATCTCCCGGGAGGTCGCCTGCGCCCTCGCCGGTTCCCTTCCTTGGGATCTCGAGGCCGAGGTAGCAGCTGCGGTATACCGGCGCAGAACACAGTCCCTGAGTCGGGGACGGACGCCCGGCCCTTCGGCTGTCGGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCCGAGTGGAGGGAGCGGTTGCTGGAGGAGCTTGGCCAAACTTCACTCACTCGCCGACGCACCCTCGAGGCCCTGGTGCCCGTGCTGGAGGCATGGTTAGATAGACGACACGGCGTGCTCTCCTTCCACCTAACGCAGGTCCTCTCGGGGCATGGTTGCTTCGAGAGGTACCTGTGGAAGGTTTGCAGGAGAGAGCCACATCCGGGTTGCCACCAGTGTGGGCATCCGGATGATGACGCTCAGCACACACTCGAAGGGTGCCCGCGTTGGGAGCGCTCGCGGCGAGACCTCATCACGGTGCTGGGGAGAGACCTCTCCTTGCGGGCTGTCATCGCCCGCATGCTAGAGGACCAGAATTCTTGGGAGGCCATGACCAGGTTTTGCGACCTGGTCATGGCGTTCCGTGAGGCTGAGGAGCGCGAAAGGGAGTGGGATCCCTCTTCGGCTTCTCAGCGAAGAAGGCGGAATGGACGGCACGGGCGCGAAGCTCCCGTTCATCTCCCGTAG
Protein
MDAVLRVRHLSDRACSEGGVLLAVSIDIANAFNTIPWSTIVESLRFHRVPPSLRTLIEDYLSGRNVVFPERRGWGRKAVSCGVPQGSVLGPLLWDIGFDWVLRGASLRGVDVVCYVDDTLVTARGADYRAAAILATAAVSTVVSRIRRLGLEVALRKSEAVCFHPVRRGPPPGANLIVGGVSIAVQPKLKYLGLVLDSRWRFDHHFGELVPKLLGMAGALARLLPNVGGCSAGVRRLYLGVVRSMALYGAPVWSPALSARNAALLLRAQQVLAVRVIRGYRTISREVACALAGSLPWDLEAEVAAAVYRRRTQSLSRGRTPGPSAVGRWRRAARHLAYAEWRERLLEELGQTSLTRRRTLEALVPVLEAWLDRRHGVLSFHLTQVLSGHGCFERYLWKVCRREPHPGCHQCGHPDDDAQHTLEGCPRWERSRRDLITVLGRDLSLRAVIARMLEDQNSWEAMTRFCDLVMAFREAEEREREWDPSSASQRRRRNGRHGREAPVHLP

Summary

EMBL
D85594    BAA19776.1    AB078935    BAC06462.1    AB078930    BAC06454.1    + More
AB078931    BAC06456.1    AB078929    BAC06452.1    AB090825    BAC57926.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    KZ150386    PZC71062.1    LBMM01024063    KMQ82623.1    LBMM01019839    KMQ83438.1    LBMM01006954    KMQ90166.1    LBMM01019838    KMQ83439.1    LBMM01006725    KMQ90373.1    LBMM01015018    KMQ84954.1    KQ460685    KPJ12887.1    LBMM01005733    KMQ91252.1    LBMM01004505    KMQ92346.1    LBMM01003245    KMQ93755.1    LBMM01004272    KMQ92618.1    LBMM01002052    KMQ95336.1    LBMM01015025    KMQ84953.1    LBMM01006671    KMQ90407.1    LBMM01007036    KMQ90099.1    LBMM01005216    KMQ91703.1    LBMM01006657    KMQ90417.1    LBMM01002480    KMQ94776.1    LBMM01008682    KMQ88705.1    LBMM01004634    KMQ92224.1    LBMM01003988    KMQ92922.1    LBMM01008422    KMQ88894.1    LBMM01006063    KMQ90967.1    LBMM01014122    KMQ85315.1    LBMM01005465    KMQ91492.1    LBMM01014956    KMQ84982.1    LBMM01007425    KMQ89740.1    LBMM01008448    KMQ88867.1    LBMM01005474    KMQ91485.1    GFXV01002242    MBW14047.1    LBMM01012412    KMQ86235.1    KMQ94772.1    LBMM01005948    KMQ91066.1    LBMM01008278    KMQ89009.1    LBMM01021647    KMQ83033.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GDHF01014602    JAI37712.1    LBMM01013668    KMQ85535.1    AAZX01012143    AAZX01012194    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GAKP01002292    JAC56660.1    GALX01004785    JAB63681.1    KU543679    AMS38363.1    GGMR01006838    MBY19457.1    GGMR01004600    MBY17219.1    ABLF02011238    GFXV01002090    MBW13895.1    GFXV01003903    MBW15708.1    AB090814    BAC57904.1    QOIP01000031    RLU14697.1    LBMM01015285    KMQ84870.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GGMR01000779    MBY13398.1    ABLF02041886    GGMR01011682    MBY24301.1    GDHC01002080    JAQ16549.1    ABLF02009991    ABLF02009992    ABLF02054952    GEHC01000915    JAV46730.1    ABLF02013358    ABLF02013361    ABLF02054869    GAPW01000192    JAC13406.1    AB593326    BAK38647.1    ABLF02034925    GALA01001777    JAA93075.1    ABLF02018471    ABLF02058352    GFXV01001748    MBW13553.1    QOIP01000010    RLU18098.1    KQ972691    KXZ75805.1    GALA01000302    JAA94550.1    GEHC01000964    JAV46681.1    ABLF02018942    ABLF02041885    GGMR01014195    MBY26814.1    ABLF02005203    ABLF02041316    ABLF02041323    ABLF02041325    GGMR01015354    MBY27973.1    LBMM01006496    KMQ90570.1    ABLF02011183    ABLF02041884    GALA01001776    JAA93076.1    GBXI01013438    JAD00854.1    GGFL01001583    MBW65761.1    LBMM01007659    KMQ89538.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
506
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.34288
Exp number, first 60 AAs:
1.1515
Total prob of N-in:
0.06238
outside
1  -  506
 
 

Population Genetic Test Statistics

Pi
146.384462
Theta
20.275563
Tajima's D
1.594822
CLR
0.381483
CSRT
0.812909354532273
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号