SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02809
Annotation
reverse_transcriptase_[Anopheles_gambiae]
Location in the cell
Mitochondrial   Reliability : 2.466
 

Sequence

CDS
ATGGTCACATTCTGGCGCAACTTGTGGTCAAGACCTGTGGAGCATGTGGAGGGCTCCTGGATGCAGGTCATTGAGGACTCGTGTGCGGGCATACCACCGATGAGCCCGGTTACTATCAGCAAAGGTGATATTAAGGCTGCAGTCTGTAGTTCTTCACACTGGAAGTCTCCAGGCTGCGACGGACTGCAGCTTTACTGGCTAAAAAGTTTCCGGGCTTGTCACGAAACCCTCGCCAGACAGTTCCAGGAAGCCCTAGATACAAAAGTGCTCCCCGCCTTCCTCACTACTGGGATCACTCACCTCATTCCAAAATCGGAAAGTACCGCGGATCCGGCACAGTACCGGCCAATAACGTGTCTTCCTACCACCTATAAGACACTGACATCCGTTCTGGAAACTAAGATCTCACACCACATAGACAGCTGTCGAGTACTGTCTGGTGCCCAGAACGGGTGTAGGCGTGGTAGCCGCGGTACTAAGGAACTCCTCTTGATCGACGCGGTAGCTGGCCAGCAGGTCAAACGCAACCGACGAAATTTCTCTGCCGCCTGGATAGATTATAAAAAGGCATTTGACTCGGTCCCCCATACATGGCTGAAGAGGGTCCTCGAGCTGTATAAGATAGACGATACAGTTCGAGACTTCCTCGGTGCCTGTATGGGGCAATGGAGTACAATGCTTAGTCTATCCGGTGTGCGGCTGTCGGCTGTAGAAGACCGAATAAAGGTGAATCGGGGTATATTTCAGGGTGATTGTCTGAGTCCATTGTGGTTTTGCCTGGCCCTGAATCCTCTCAGTTCATTACTGGAGGCTTCGAGGACAGGCTTTCAGTTCCGAAGGGGGGGCTTGAAGGTGTCCCACTTGTTCTACATGGATGACCTCAAGTTGTACGCTCCTCATGCTGCAGGCCTCAGGCGACTGCTTGACATCACTTGTGATTTCAGTAGTCGCATTAGGATGAGGCTGGGAGTCGACAAGTGTGCGGTTCTCCATGTAGAGAGAGGGAGCATAGTCTCATCGGATCGTTTACCTGTATCCGATGGGATAAACCTTCGGGCACTCTCCGAGGGAGAAACATACCGGTACCTGGGCATGTCGCAAAATTTAGGTATTGACGTGGCGGTCGTCAAACAAGCTGCATGCGACGTGTTTTATGAACGTTTGACAAAAGTGTGTAAGAGCCTTTTGTCGGGCGTGAATAAGACAAGGGCGTTTAACGGCTGGGCGATGCCCGTCCTGTTGTATACCTTCGGCGTGCTCAGGTGGACTCAGACCGAACTGGATGCCCTGGATAGAAAAGTCCGCTCAATTATGACCCTCCATAGGATGCTCCACCCGAAGTCCTCGGTAATGAGATTGTACATTCCGCGGAAGTGTGGTGGCCGGGGCCTACTTAGTGCCAAGGTCATGCACAACAGTGGGGTGTGCAGTCTCAGGGAATATTTCCTATCGAGGGCTGACAGTGTGATGCACAGAGAGGTCATGGAATGCGACAAAGGACTGACCCCGCTAGCCCTGGCCAGAGACGGGTGGCAATCACCGGCGGTACTCAGTACCTCTGACCGTGAGGCCATATGGAAAGGGAAAGAGCTGCACGGACGCTTCTTTCAGGCACTGCATGAGCCCCACGTGGACAAAGAAGCCTCCGTGCACTGGCTGCGATTCGGTGACCTCTTTGGGGAAACCGAGGGTTTTGTCTGTGCAATACAGGATCAGGTTATCAGGACGAACAACTATAGGAAGCACATTCTGAGGGATGGGACAGCTGACATCTGTCGATTATGCCGCCGACCGGGTGAATCCCTCAGACATGTCACCTCTGGTTGTTCTATGCTTGCTAACACTGAGTACTTGCACAGACATAACCAAGCAGCCAGAATCCTCCACCAAGAGCTCGCCCTTAAGTATGGCCTCATCGAACAGAGGCTACCGTATTATAAGTACCAGCCGGACGCTGTACTCGAAAACGACCGTGCCAAGCTCTACTGGGACCGGCCCATCATTACGGACAGGACTATTCTTGCGAATAAGCCTGATATCGTGCTGATGGACCGGACGGAGTCTCGGGTATTTCTGGTGGATATCACCATCCCCTACGACGAGAACCTCGTGCGGGCCGAGGCAGATAAAAAGACCAAATATTTGGACCTGGCGCACGAGGTGACCGACATGTGGAGGGTGGTATCTACAGAAATAATCCCGGTAGTTGTGTCGGTGAATGGTTTGGTCCCTAAAAGCCTCTCAAAACATCTCGAGAGGCTTGGTCTCAACAAAAAGTCGGTGGTGGCCCAAATGCAAAAGGCAGTCTTGCTCGATAATGCCCGTATAGTTCGCCGGTTTCTCTCCCAATAG
Protein
MVTFWRNLWSRPVEHVEGSWMQVIEDSCAGIPPMSPVTISKGDIKAAVCSSSHWKSPGCDGLQLYWLKSFRACHETLARQFQEALDTKVLPAFLTTGITHLIPKSESTADPAQYRPITCLPTTYKTLTSVLETKISHHIDSCRVLSGAQNGCRRGSRGTKELLLIDAVAGQQVKRNRRNFSAAWIDYKKAFDSVPHTWLKRVLELYKIDDTVRDFLGACMGQWSTMLSLSGVRLSAVEDRIKVNRGIFQGDCLSPLWFCLALNPLSSLLEASRTGFQFRRGGLKVSHLFYMDDLKLYAPHAAGLRRLLDITCDFSSRIRMRLGVDKCAVLHVERGSIVSSDRLPVSDGINLRALSEGETYRYLGMSQNLGIDVAVVKQAACDVFYERLTKVCKSLLSGVNKTRAFNGWAMPVLLYTFGVLRWTQTELDALDRKVRSIMTLHRMLHPKSSVMRLYIPRKCGGRGLLSAKVMHNSGVCSLREYFLSRADSVMHREVMECDKGLTPLALARDGWQSPAVLSTSDREAIWKGKELHGRFFQALHEPHVDKEASVHWLRFGDLFGETEGFVCAIQDQVIRTNNYRKHILRDGTADICRLCRRPGESLRHVTSGCSMLANTEYLHRHNQAARILHQELALKYGLIEQRLPYYKYQPDAVLENDRAKLYWDRPIITDRTILANKPDIVLMDRTESRVFLVDITIPYDENLVRAEADKKTKYLDLAHEVTDMWRVVSTEIIPVVVSVNGLVPKSLSKHLERLGLNKKSVVAQMQKAVLLDNARIVRRFLSQ

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001611   Leu-rich_rpt       

Ontologies

Topology

Length:
783
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0910499999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00198
outside
1  -  783
 
 

Population Genetic Test Statistics

Pi
180.837654
Theta
72.374744
Tajima's D
4.143026
CLR
0.453829
CSRT
0.99930003499825
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号