SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02798
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.419 PlasmaMembrane   Reliability : 1.421
 

Sequence

CDS
ATGGACCGCACCTATCGCTTCCTCCAAGGAAACCTAAACCACTCCGCCAGAGCTGAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATATGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGCTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCTTAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGTCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAATAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTATTGGAGAGGTGGGCGCACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGATCACCCCCGTGGTGCATCCCGGTCATTTCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGGTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTTGCATTTGTGATGCGTCGATGCCCCGGATCGGCCCTAGACTCCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAATGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGAAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGAAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGCGAAGTCCCTGCTGAGGTGCCCCGTATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAAGACACTGCACCCGGCCCTGACGGCGTGCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATCCAGTATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGACGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCTCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCCTACCTTTGCCGGCTGGTGGGTTCCTACTTGGAGGACCGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTACTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATTTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAAGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGTGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCGGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACAAGGCGCCTGTGTGGGACCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCTCGGTCAGGGTCATTCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTAGGACGCCGCCTTGGGCTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGCGCCCGGGGCCCAGCCACAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGA
Protein
MDRTYRFLQGNLNHSARAEDMLSQSMAEWSIDMAVVAEPYFVPPANDCWFGDDGGLAAIVLRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWAHAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKEVLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRCICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQKREGFVAPAMDAPPEYDGEVPAEVPRITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQYLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEDVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLCRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIKRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNVGGPDRVTRRLYTGVVRSMALYKAPVWDQSLAAGVAKLLQRPQRTISVRVIRGYRTISFEAACVLARTPPWALEAEALAADYQWRADLRARGPATVWSERGGPNLGGPCWSHGPDGWLILRPVVGPSRRFARSLWIG

Summary

EMBL
AB090825    BAC57926.1    AB078929    BAC06452.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078935    BAC06462.1    AB078936    BAC06464.1    D85594    BAA19776.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    AGBW02011529    OWR46521.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    LBMM01004262    KMQ92649.1    LBMM01015025    KMQ84953.1    LBMM01015285    KMQ84870.1    LBMM01008448    KMQ88867.1    LBMM01007036    KMQ90099.1    LBMM01006657    KMQ90417.1    LBMM01004634    KMQ92224.1    LBMM01002052    KMQ95336.1    LBMM01003988    KMQ92922.1    LBMM01008445    KMQ88871.1    LBMM01014122    KMQ85315.1    LBMM01008422    KMQ88894.1    LBMM01005474    KMQ91485.1    GGMR01015159    MBY27778.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01008226    KMQ89040.1    GGMR01006838    MBY19457.1    ABLF02034925    LBMM01009610    KMQ87992.1    LBMM01009535    KMQ88053.1    LBMM01007425    KMQ89740.1    LBMM01006996    KMQ90130.1    ABLF02011238    LBMM01004261    KMQ92650.1    GALA01001777    JAA93075.1    LBMM01006977    KMQ90149.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02009073    ABLF02030702    ABLF02042963    GGFJ01001369    MBW50510.1    GGFJ01001439    MBW50580.1    GGFJ01001370    MBW50511.1    GGFL01004044    MBW68222.1    ABLF02030663    ABLF02041312    GGFJ01001541    MBW50682.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    GGMR01019493    MBY32112.1    GDAI01000741    JAI16862.1    GGFK01005660    MBW38981.1    GGMR01012748    MBY25367.1    AB090815    BAC57906.1    ABLF02018098    ABLF02018942    ABLF02041885    ABLF02011183    ABLF02041884    GFXV01002090    MBW13895.1    AB593325    BAK38646.1    ABLF02023257    AB593327    BAK38648.1    GGFK01006563    MBW39884.1    GGFL01001916    MBW66094.1    ABLF02014650    LBMM01002480    KMQ94776.1    ABLF02027248    GGFJ01001453    MBW50594.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GGFJ01001454    MBW50595.1    LBMM01003941    KMQ92970.1    ABLF02041886    ABLF02004854    ABLF02041317    KQ971388    KYB24913.1    KU543679    AMS38363.1    AB090817    BAC57910.1    GGFK01006866    MBW40187.1    KQ971675    KYB24771.1    AB593321    BAK38639.1    GFXV01003903    MBW15708.1    AB090822    BAC57920.1    ABLF02011136    ABLF02014426    KQ971309    EEZ99146.1    KU543683    AMS38371.1    GGFL01001192    MBW65370.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF00098   zf-CCHC
PF00075   RNase_H
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=5.56599e-12,     Score=175

Ontologies

Topology

Length:
926
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.16959
Exp number, first 60 AAs:
0.00086
Total prob of N-in:
0.00497
outside
1  -  926
 
 

Population Genetic Test Statistics

Pi
11.479583
Theta
13.027453
Tajima's D
-2.292113
CLR
308.15499
CSRT
0.00259987000649968
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号