SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02664
Pre Gene Modal
BGIBMGA001503
Annotation
PREDICTED:_uncharacterized_protein_LOC105842132_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.675
 

Sequence

CDS
ATGGAGGCGGCGTGTCTCAAACGTATGGAGGATCTCAACCAAACCCATCGGAGAACCAGCAATAGTAGAATCCTTACCAAAAAACTCTGCGCCGGCAACAAACAATCTAGCACCAGAATAGGAATCTTACAAATTGAGAACATTTCATACCAGATTACAAACGACTACTCACAAATTGAAACGTTCTACCCATCTCTCAACTTTCTCTACGCCAATGTACGCAGCATTGTTAAGCCGGGAAAGTTTGATGAGCTCAAGTGCGTCCTGAAGTCTATCGATAAGGGTGTACACGTTGTTCTTCTCACCGAAACTTGGATCAAATCTGAAAATGATGCCATGAAACTACATTTGCCAAATTACACTCATCATTACAGCTATCGTAACGACATCAGAGGAGGCGGCGTGTCTATATACGTCCATAATAATATCAAACACAGCACGACTGAAGATAAATACAGCAATGGCAATAACTATCTTTGGGTGTATCTTGAGCAACATGGATTACACGTTGGAGTTGTATACAAGCCAGGAAGCACAAATACAGAAGATTTTCTTATCGATTATGAACAGCAACTACATGACAGAAATCGAACCATTATTTTCGGGGATTTCAACCTAGACCTATTACAAGAAGACAAACAAACTAAAATGTATAAACAAATGCTTTGCGAAAATGGATATAAAATATTGAATAAAGTAGAAGAAGAATACTGTACAAGAGAAACGTCGACAACTAGGACAATTTTGGATCATGTTACAACAAATTTAAAGAATAAAAACGTACACTTAGCCATTGTTGAATCTTGTATGTCGGATCATAAACAAATTTACGTCGCAATAAAAAAACAACAAGTAATTTCAAAACAAAGGAGTAAATACGAGGCCATAGACTATAGCAGCCTATATAAAAAATTTGATTCAAGCAAATTAGACAATAGTAACTATGAATACAAACATTTGGAAGATGTTATAAAACAGAATATTCGTGAAAACACTAAGACAAAATCGAAAATACTTAATTTGCCACAACAGGACTGGATAACAAAAAATATCACTGATGGAATAAATAGAAGAAATAAACTGTGGTACAAGCTGAAAAAGGACCCGAATAATGAAGACCTCAAAGCTAATTTCAAAACTGAAAGAAACCAGGCACAACCTTGGCCGATAAAATTCCTCAGAAATTTCATGGAAATCATACGCATACCTTACCAAATAACTCTGTGA
Protein
MEAACLKRMEDLNQTHRRTSNSRILTKKLCAGNKQSSTRIGILQIENISYQITNDYSQIETFYPSLNFLYANVRSIVKPGKFDELKCVLKSIDKGVHVVLLTETWIKSENDAMKLHLPNYTHHYSYRNDIRGGGVSIYVHNNIKHSTTEDKYSNGNNYLWVYLEQHGLHVGVVYKPGSTNTEDFLIDYEQQLHDRNRTIIFGDFNLDLLQEDKQTKMYKQMLCENGYKILNKVEEEYCTRETSTTRTILDHVTTNLKNKNVHLAIVESCMSDHKQIYVAIKKQQVISKQRSKYEAIDYSSLYKKFDSSKLDNSNYEYKHLEDVIKQNIRENTKTKSKILNLPQQDWITKNITDGINRRNKLWYKLKKDPNNEDLKANFKTERNQAQPWPIKFLRNFMEIIRIPYQITL

Summary

Similarity
Belongs to the cytochrome P450 family.
EMBL
BABH01005955    BABH01005956    BABH01005957    JTDY01005746    KOB66672.1    JTDY01000106    + More
KOB78836.1    JTDY01001032    KOB75078.1    KOB75077.1    JTDY01005835    KOB66566.1    JTDY01005656    KOB66776.1    JTDY01000656    KOB76313.1    JTDY01005628    KOB66807.1    ODYU01002150    SOQ39280.1    NWSH01000688    PCG74776.1    JTDY01002817    KOB70659.1    JTDY01001257    KOB74378.1    GANO01002979    JAB56892.1    GFWV01022122    MAA46850.1    GACK01003803    JAA61231.1    GACK01003878    JAA61156.1    GACK01000380    JAA64654.1    GACK01003889    JAA61145.1    GFWV01017766    MAA42494.1    GGLE01003890    MBY08016.1    GACK01002596    JAA62438.1    GEBQ01027994    JAT11983.1    GACK01003815    JAA61219.1    CVRI01000047    CRK98448.1    AAGJ04008561    AMQM01006321    KB097379    ESN97412.1    AMQN01026742    KB307264    ELT99048.1    AMQN01031095    AMQN01031096    KB310472    ELT91461.1    GACK01010154    JAA54880.1    GEGO01003737    JAR91667.1    GEGO01003346    JAR92058.1    JTDY01000313    KOB77743.1    AMQN01037559    KB293652    ELU15682.1    JTDY01005729    KOB66686.1    GEGO01003474    JAR91930.1    GEGO01003344    JAR92060.1    GFWV01009040    GFWV01009041    MAA33769.1    GGMR01009684    MBY22303.1    GFWV01000182    MAA24912.1    GECU01034449    JAS73257.1    GEGO01007172    JAR88232.1    JTDY01001811    KOB72812.1    GEGO01003604    JAR91800.1    CVRI01000059    CRL03366.1    GEGO01004417    JAR90987.1    GEGO01000196    JAR95208.1    GACK01000076    JAA64958.1    GEGO01004368    JAR91036.1    GEFM01002318    JAP73478.1    JTDY01007074    KOB65472.1    AMQN01005457    KB296106    ELU12238.1    GEGO01007379    JAR88025.1    GFWV01001118    MAA25848.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00067   p450
PF11461   RILP
PF10174   Cast
PF00078   RVT_1
PF03372   Exo_endo_phos
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036396   Cyt_P450_sf       
IPR017972   Cyt_P450_CS       
IPR001128   Cyt_P450       
IPR002401   Cyt_P450_E_grp-I       
IPR034744   RH2       
IPR021563   RILP_dimer       
IPR019323   ELKS/CAST       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF48264   SSF48264       
Gene 3D

Ontologies

Topology

Length:
408
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00152
Exp number, first 60 AAs:
0.00031
Total prob of N-in:
0.01386
outside
1  -  408
 
 

Population Genetic Test Statistics

Pi
31.729443
Theta
163.410618
Tajima's D
0.713838
CLR
474.1681
CSRT
0.578221088945553
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号