SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02662
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.785
 

Sequence

CDS
ATGTTCCGCGCTTCATTCAGGTGTTGCCTCGATCTCACCTCCAACATCCTACCTCTCCTAATCCTACTCTCCGAAAACTTAAACATCATGAAGACGACAAAAAAAAAGAAAAGGGTTTCACAGGCGGTCCCCCATTCCACATTTAATGTGGATTTCAGCAATGTCAGGGGCCTACATAGCAACCTTGACGCCGTACACCACCACCTTGAGACGGCGCAGCCTGCCCTGCTTTTTTTAACGGAGACGCAGATATCTGCTCCGGATGATACCTCATACCTTGAATACCCCGGCTACGTATTGGAGCACAACTTCCTGCGTAAAGCCGGGGTGTACGTATTCGTCCGGGCTGATGTCTGTTGTCGCCGTCTTCGGGGCCTCGAACAACGGGACCTGTCCCTCTTGTGGCTGCGCGTAGATCACGGGGGCCGTAGCCGAATCTACGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGGTTCAGCTCTGTTTGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTGGTGGTTCTTGGAGACTTTAACGCTCACCACCAAGAGTGGTTGGGATCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTGGCCTACGGCTTCTCCCAGCTGGTGACACAGCCCACCCGTATCCCAGATATCGAGGGGCACGAGCCTTCTTTGTTGGACCTTCTGCTGACCACAGATCCGGTCGGATACAGTGTGGTGGTCGACGCTCCGCTTGGATCGTCTGATCACTGCCTTATTCGTGCTGCCGTACCACTCTCTCGTCCTGATCGTCGAACGACGACCAGGTATCGAAGAGTTTGGCGGTATATGTCAGCAGACTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACTTCAAGCGGTCCGCATACGTGGCATGGGATAATGCCAGGAGACGTCGGGATCCTAACATCTCAGGGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTAATTGCCAAGGCGAAGTCGGAGCACGTCGCTAGAGTTGGCGAGCGATTGAAGAGCTATCCCTCCGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGAAACTTCTGCAGGTCTAGTCTCCCACCACTGCGCAAGTCCGATGACAATCTGGCCCACAGCGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATCCCCCGGTGTGATAGCTCCCTGCCGGAAATCTGCTTCACACAGTGTGCAGTCAGGTGGGAGCTCAGACTCCTGGACGTCCATAAGTCGAGTGGGCCAGACGGCATCCCCGCAGTGGTTTTGAAAACGTGCGCCCCTGAGCTGACACCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCACTAACAGGGTTCCGTCTTCATGGAAGACCGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTACAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATTATAAATACACAACTCCTGAAGTATCTTGAAGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCAGATGATAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGGTGAATCGAACTTAGTTCAATTCAACCCGTTGAAGACACAGGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCAGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGATCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTATTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTATGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MFRASFRCCLDLTSNILPLLILLSENLNIMKTTKKKKRVSQAVPHSTFNVDFSNVRGLHSNLDAVHHHLETAQPALLFLTETQISAPDDTSYLEYPGYVLEHNFLRKAGVYVFVRADVCCRRLRGLEQRDLSLLWLRVDHGGRSRIYACLYRSHSSDAGSALFEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRTAYDFALAYGFSQLVTQPTRIPDIEGHEPSLLDLLLTTDPVGYSVVVDAPLGSSDHCLIRAAVPLSRPDRRTTTRYRRVWRYMSADWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHFKRSAYVAWDNARRRRDPNISGERRKYNAASRSYKKVIAKAKSEHVARVGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDNLAHSAKEKADLLVKLFASNSTVDDGGATPPNIPRCDSSLPEICFTQCAVRWELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCTNRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINTQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSKWGESNLVQFNPLKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILSDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRR

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF02460   Patched
PF00096   zf-C2H2
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR030223   Dispatched       
IPR003392   Ptc/Disp       
IPR000731   SSD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR011011   Znf_FYVE_PHD       
IPR019787   Znf_PHD-finger       
IPR013083   Znf_RING/FYVE/PHD       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57903   SSF57903       
Gene 3D
PDB
6AR3     E-value=0.00034485,     Score=108

Ontologies

Topology

Length:
1014
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17353
Exp number, first 60 AAs:
0.17044
Total prob of N-in:
0.00896
outside
1  -  1014
 
 

Population Genetic Test Statistics

Pi
15.595916
Theta
105.940984
Tajima's D
0.52684
CLR
0.363874
CSRT
0.520073996300185
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号