SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02641
Annotation
PREDICTED:_uncharacterized_protein_LOC101740474_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.085 Extracellular   Reliability : 1.006 Nuclear   Reliability : 1.567
 

Sequence

CDS
ATGGTGTTAAATATTTGTGCTGTGTACATCCCATCTCCTTTGAATGTTGATTATGTCGACATTTTTACCAAAAATACTGTGCAGGTTATTCACAACAACATGACAAAAGGTATTACTGAACCATTATTTCTTTTAGTAGGAGACTTTAATATGGGGGATATTGAGTGGTGTAAAGATAATTCTTCTGCATATATGACCCCATCAACATCAGGGAATAATGTCTATACAGAATTTTTAGATGCCATGTCTTACTGCGACCTTTATCAGTTTAATGATATGATCAACGCTAATAATCGAATCCTTGACTTGGTATTTAGTGGTGCGTCAAGTCATATCTCAATTGAATCTGCCAAGGGCTTTTCGACTGCACCTGACCCATACCATCCGCCACTGGACATTGCATTTCAAGAAACATCTGTGCATGTTGTGAAACCTGACTCTGCCCCAGCATTAAACTACTTCAAATCCAATTATGAGGCTCTGAATAAAGACTTAAAGCAGGTTGATTGGACCAACTTACTACAAGAATCATATTCTGTGGATACAATGAATGCTCCCAATCATCTCAAAAACCGTCCGAAATACTTCTGGAAAATTTTTAAGGATAAAACAGCTAATAGTCGTTCTTTGCCTAACGAAATGAAGCTTGGTCGGGTAGAGGCTAAGGGAGGACAGGAGATCTCTGAATTATTCTCTCAACATTTCCAAAGTGTGTATGATTCCAACATTAATCATGAAACAAGTTGCTCCTCTCATTATTGTAATGTGTCCGGCAATGCATCATATAATATCGTTGAAGTTAATGAAACCGAAGTTTTAAATCAGCTAAAGCTTTTAAATGCGGACAAAGGACCTGGCCCTGATTTGATACCTCCTATATTCATAACAAAATGTGCTCTAAGTTTATATAAACCTCTAGCCAAAATTTATACCAAATCTCTCCAAAGTGGTGCTTACCCCACTCAGTGGAAATTAGCGCACTTAACACCGATCCACAAGGATGGGAGGCTGGATGATATAGCCCAATATCGACCTGTCTCCATACTGTCTGGGTTTGGCAAGGTATTGGAAGCCATAGTTAATAAAAAACTGATAACTCATTTCAAGCAATCTATAGACACAAATCAACACGGCTTTCTGCCATCCAAATCGACAAATACTAACTTAGTTAGTTATGTTTCTGATATAATTGATACTATGGACGGAGGTGGCGAGGTGCACTCTATCTACACCGATTTCAGAAAGGCGTTTGACCTAGTTAACCATAACTGCCTATTACACAAGCTTGCAGAACTGGGCATCCATGGATCGTTACTGAGATGGTGCGAGTCGTACATACGCAACCGCTCGCAATTGGTAAACATTCAAGGGTTTAAATCTAGAGTGCACATGGTCCCATCAGGGGTCCCTCAAGGGTCTCATCTAGGTCCTTTCTTTTTCCTAGTCTACATCAATAACATTAAGCATGTCATCCAATCTAAATTTAAATTATATGCTGATGACTTAAAAGTGTATCGTGCTGTTGAAGACCATTCGGATATAATGGCTCTTCAGTCAGATATCAATGCGATTTACAAATGGAGTACGCAGAATTACATGCACTTGAATTTGCAAAAGAAAAATAATCAAGACCATGATGAGGCTGAAGATGAAATCATGACCAATTAA
Protein
MVLNICAVYIPSPLNVDYVDIFTKNTVQVIHNNMTKGITEPLFLLVGDFNMGDIEWCKDNSSAYMTPSTSGNNVYTEFLDAMSYCDLYQFNDMINANNRILDLVFSGASSHISIESAKGFSTAPDPYHPPLDIAFQETSVHVVKPDSAPALNYFKSNYEALNKDLKQVDWTNLLQESYSVDTMNAPNHLKNRPKYFWKIFKDKTANSRSLPNEMKLGRVEAKGGQEISELFSQHFQSVYDSNINHETSCSSHYCNVSGNASYNIVEVNETEVLNQLKLLNADKGPGPDLIPPIFITKCALSLYKPLAKIYTKSLQSGAYPTQWKLAHLTPIHKDGRLDDIAQYRPVSILSGFGKVLEAIVNKKLITHFKQSIDTNQHGFLPSKSTNTNLVSYVSDIIDTMDGGGEVHSIYTDFRKAFDLVNHNCLLHKLAELGIHGSLLRWCESYIRNRSQLVNIQGFKSRVHMVPSGVPQGSHLGPFFFLVYINNIKHVIQSKFKLYADDLKVYRAVEDHSDIMALQSDINAIYKWSTQNYMHLNLQKKNNQDHDEAEDEIMTN

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001841   Znf_RING       
IPR013083   Znf_RING/FYVE/PHD       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5G2X     E-value=0.0338566,     Score=88

Ontologies

Topology

Length:
555
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.61413
Exp number, first 60 AAs:
0.00631999999999999
Total prob of N-in:
0.00156
outside
1  -  555
 
 

Population Genetic Test Statistics

Pi
203.165829
Theta
186.182357
Tajima's D
1.348097
CLR
235.439681
CSRT
0.749862506874656
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号