SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02624
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.129
 

Sequence

CDS
ATGTCGGTCGGGCAGTTGAAAGAATTCGCGGTAAACAGTGGAAATTGGTCCTCATATGTTGAGAGATTAGAAATGTACTTCTTGGTGAATAAAGTGACTGACGATTTAAAATTACCCACATTAATTTCCGTTATGGGTGAGGAAGCGTACGATTTATTATCGACATTAGCCAGCCCTTCGAAGCCGTCACAGTTAACTTATGCTAATGCCGTGGCGATGTTGGCAGCTCACCTGCAACCGAAGCCCTCAATCTTGGCGGAAAGATACAAGTTTCGACAACGTCGGCAGCTGAATGAGTCAATAGCTGACTACGTCACAGAATTAAAAAAATTATCAAAAAATTGTGAGTTCGGCTCGTCGCTGGATGAAAATCTGCGTGATCAAATGGTTTGTGGATTAAAGAGCGAAATCATACGGCAAAGGTTATTTGCCGAGGAGAAATTAGAATATAAGCGAGCAGTTACGTTAGCTTTGTCTTTAGAAGCTGCGGAGAGGGATGCGATTGCAGTGGAACGTACGCCAATTGAGGAGGTTAACAAAATTAACTTCAATGAATGTTCAAGATGTGGAGACAGGAGACACCAAGCAAAGGATTGCATATACAAAGACTACGTGTGCAGTTCATGTCATGAAACCGGCCATCTACGAAGAATGTGCCCCAAAAAAGGGCTTAAGAACCAGGCGGAGGCAGCCGGGGGTTCACCATGCACCGGGCGCCGGGGGAACCGGGGTGCAGGCGGCAACAGGCGATCGTGGCGCGGGCAGCGCGGTGCGGGACGAGGAGGCCGAGAGCGGGCTCCTTTGCACTTATTATACGATCAAAACAACGATGACACATACAACAACTTCAATAATGAACAGGACGGGTGTGGAGAAGAAAATGAGCCTATGTACCAAATGACATTGAGTAATTATAAACCGGTGTGTATTAAAGTTAAAGTCCAAAATTGCTTGCTCAAGATGGAGGTCGATACTGGATCGGCGTTATCTTGTATTAGCAAGAATGTTTATGATAAATATTTTTCTAAGGAGAAGTTACAGGCATGCTTATTAAATTTAAAATTTTACGATGGCTCAATCATTCGGCCTTTAGGGTTTATAAACACTATAGTGAAGTACCAAGGTGTTTCAAAAATGTTAGACTTGTATGTCATAGACAAAGGAACGACTAATCTATTGGGCCGACAATGGTTAGCTGAATTGAATATTCCTATAAAAATATCAAAACCTACGAGTTTTAAAATACAACACAGTAACTTTGTAACCGAACACGCACGAGACTATAATAAATTAATTAATGAAATTGTTTCTAGACATAAATCCTTGTTCGACGGCACATTGGGTAAATATACGGGGGGCACAGCAGAGTTAATCGTGCGGCCGGATGCGGTGCCTATCTACTGCCGCGCGCGACCGCTGCCGTATGCGCTGCGCGAGCGCGTCGATGCCGAGCTCGACGCGATGCTGGCCGCCGGCGTCATCAAACCGGTGGACCACTCCGACTGGGCCACGCCACTTGTCGTAGTACGCAAAGCGGACGGCGCTCCCTATCATCCCGCCTCTAATGGGGCCGCTGAAAATGCAGTTAAAATTTGTAAACGTGCGATTAAAAAGGCATTAAAACAGAATTTAAACGTAGATACAGCTCTGTGTAGATTTTTATTAGCCTACAGAAATACAGAACATGCAACTACCGGCGATAGTCCAGCCAATATATTACAGGGTCGAAGTCTCCGTATGAGATTAGATAATTTAAAACCAGAAAGGCAATCTCGAGTTATCGCGCAACAAGAGCGGAGCGAGCAAAACGCAGGGGGTGTGCAGCGACAACTCGAGCCGGGCACTAAGGTGTGGTATCGGGATTATCGAGGTCTGGATAAATGGGTACCTGGGACGATCCTCAAGCAATTAGGTAGTCGTGATTACTGTGTACGATCTAGTTTTGGAACCGAGAATCATAGGCACGTCGATCAGCTAAAATTAAGGGTTACAAAAAATATAGATAAAGTTGATACCTTTGCGTCGATTCGTAAAAATATAAGTCCCGAACTGATCGCGCAAAATTTAGACTTAAGAACACAATCACGTAAGTCGCTATCATTTCCCATGACAAGTGGCGAGGAACCAGTGGCGGTGGTCAACGATTCGGGGAAGAGTAGTTCACCACCAAAAAATAGCACACCGGCACAGGATGCTGTATCGCCTATTCGTGGCAGCCCTATGAGACCCGCTGTGCCGATAGACAAGGCAGCATGTAGTACTGGTGGTAAGAGTATCAATGAAAATGTGACACCCAAACGTGAACGTCCTGTAAGAATACGCAAGCCACCAGTTAGATATGGATTCGAGGAAATAGATTAA
Protein
MSVGQLKEFAVNSGNWSSYVERLEMYFLVNKVTDDLKLPTLISVMGEEAYDLLSTLASPSKPSQLTYANAVAMLAAHLQPKPSILAERYKFRQRRQLNESIADYVTELKKLSKNCEFGSSLDENLRDQMVCGLKSEIIRQRLFAEEKLEYKRAVTLALSLEAAERDAIAVERTPIEEVNKINFNECSRCGDRRHQAKDCIYKDYVCSSCHETGHLRRMCPKKGLKNQAEAAGGSPCTGRRGNRGAGGNRRSWRGQRGAGRGGRERAPLHLLYDQNNDDTYNNFNNEQDGCGEENEPMYQMTLSNYKPVCIKVKVQNCLLKMEVDTGSALSCISKNVYDKYFSKEKLQACLLNLKFYDGSIIRPLGFINTIVKYQGVSKMLDLYVIDKGTTNLLGRQWLAELNIPIKISKPTSFKIQHSNFVTEHARDYNKLINEIVSRHKSLFDGTLGKYTGGTAELIVRPDAVPIYCRARPLPYALRERVDAELDAMLAAGVIKPVDHSDWATPLVVVRKADGAPYHPASNGAAENAVKICKRAIKKALKQNLNVDTALCRFLLAYRNTEHATTGDSPANILQGRSLRMRLDNLKPERQSRVIAQQERSEQNAGGVQRQLEPGTKVWYRDYRGLDKWVPGTILKQLGSRDYCVRSSFGTENHRHVDQLKLRVTKNIDKVDTFASIRKNISPELIAQNLDLRTQSRKSLSFPMTSGEEPVAVVNDSGKSSSPPKNSTPAQDAVSPIRGSPMRPAVPIDKAACSTGGKSINENVTPKRERPVRIRKPPVRYGFEEID

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00077   RVP
PF00665   rve
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR018061   Retropepsins       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
786
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000720000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00006
outside
1  -  786
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
24.443308
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号