SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02609
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.333 Nuclear   Reliability : 1.199
 

Sequence

CDS
ATGTTGATTAAATTAGAAGCCAAACCATTTAACATCAACATTGTCCAAGTTTATGCGCCTACAGGGGATAAACCAATGGGCCAGATAGAGGACTTATATAGGGCTATTGATACCTTATTAAAATCTACTAAGAATCACGAGTTAGTTATCGTTATGGGTGACATGAATGCGAAGGTGGGTTCGACCATTACTCCTGGAGTGACTGGTGCTTATGGCCTTGGAAACAGAAACGATAGAGGGTACAAATCCGGATTTCGATCTGGTGTTGGCACCAGAGAAGCTCTTTTCGCTCTCAACGTTCTCGTACAGAAATGCAGAGACATGCAAACTGATGTCTTTTTGTGCTTCATAGACTATGAAAAGGCATTTGACCGAGTTAAACATCATCAACTTTTTAGCCTTTTATGTGATATTGGTCTAGATGGTAAGGACGTCAGAATCATCCGCAACCTGTACGAGAAGCAGGTGGCTACGATAAGAGTCGAAAACGAGGAAACCGACCAAGTTGAGATCTGTCGTGGGGTCCGGCAGGGGTGTGTCTTATCCCCGTTGCTTTTTAACATCTACTCAGAGGCTGTGATGTCAAAAGCTCTTGAAAATCTTGAAGTGGGAATAGGAATCAACGGCAGGGTCGTTAACAACTTGCGTTATGCGGACGACACTATCCTTATTGCAGCATCGGAAGCCGATTTGCAAGCAATTGTGAATAAGGTTAATGAGTGCAGCGAAGAAGCCGGGTTGTCGATAAACATAAGCAAGACCAAGTTCATGGTAGTCTCAAGAAACCCGGATTTGAGTTCAAGCGTATCTGTAGCTGGGAAACAACTAGAGCGGGTACGACAGTACAAGTATTTAGGGGCTTGGGTAAACGAAGCATGGGAATCTGATCAAGAAATCAAGACCCGGATAGAAACTGCTCGAGCCTCTTTTAATAAAATGAGGAAAGTTCTTTGCTGTCGTCAACTGAATATAAAGCTCCGAGTCAGGCTACTCATGTGCTATATCTGGCCTATCGTCATGTATGGTTGCGAAACGTGGACCCTGAAAGAGGACACTACAAGACGCCTACAGGCATTCGAGATGTGGTGCTACCGTCGCATGTTACGCATTGGTTGGACGCAGAGGAAAATCGCTTGA
Protein
MLIKLEAKPFNINIVQVYAPTGDKPMGQIEDLYRAIDTLLKSTKNHELVIVMGDMNAKVGSTITPGVTGAYGLGNRNDRGYKSGFRSGVGTREALFALNVLVQKCRDMQTDVFLCFIDYEKAFDRVKHHQLFSLLCDIGLDGKDVRIIRNLYEKQVATIRVENEETDQVEICRGVRQGCVLSPLLFNIYSEAVMSKALENLEVGIGINGRVVNNLRYADDTILIAASEADLQAIVNKVNECSEEAGLSINISKTKFMVVSRNPDLSSSVSVAGKQLERVRQYKYLGAWVNEAWESDQEIKTRIETARASFNKMRKVLCCRQLNIKLRVRLLMCYIWPIVMYGCETWTLKEDTTRRLQAFEMWCYRRMLRIGWTQRKIA

Summary

EMBL
GU815089    ADF18552.1    NWSH01002736    PCG67606.1    LBMM01001656    KMQ95932.1    + More
GGMS01004979    MBY74182.1    NWSH01001998    PCG69477.1    GBHO01028834    JAG14770.1    LBMM01003995    KMQ92919.1    GDRN01068433    JAI64193.1    HACG01049484    CEK96349.1    HACG01049485    CEK96350.1    BDSA01000081    GBE63537.1    NEVH01015334    PNF26845.1    NEVH01025130    PNF15928.1    NEVH01001347    PNF42965.1    NEVH01006590    PNF37477.1    NEVH01007402    PNF35832.1    NEVH01021229    PNF19699.1    NEVH01022635    PNF18676.1    NEVH01015827    PNF26505.1    NEVH01012097    PNF30370.1    NEVH01020937    PNF20580.1    NEVH01006565    PNF37921.1    NEVH01024955    PNF16252.1    NEVH01021219    PNF19785.1    NEVH01017534    PNF24119.1    NEVH01021208    PNF19832.1    NEVH01026425    PNF14146.1    NEVH01021956    PNF18969.1    NEVH01027118    PNF13626.1    NEVH01001338    PNF43058.1    NEVH01002684    PNF41680.1    NEVH01024426    PNF17169.1    NEVH01020871    PNF20746.1    NEVH01016289    PNF26276.1    NEVH01024527    PNF17048.1    NEVH01006732    PNF36770.1    NEVH01021197    PNF19999.1    NEVH01011186    PNF32215.1    NEVH01020341    PNF21589.1    NEVH01003502    PNF40578.1    NEVH01008283    PNF34242.1    NEVH01015905    PNF26381.1    NEVH01011198    PNF31808.1    NEVH01002690    PNF41636.1    NEVH01011192    PNF32037.1    NEVH01015826    PNF26547.1    NEVH01014359    PNF27807.1    NEVH01002704    PNF41497.1    NEVH01021193    PNF20060.1    NEVH01003505    PNF40530.1    GFAH01000222    JAV48167.1    NEVH01024544    PNF16826.1    NEVH01006832    PNF36369.1    NEVH01007823    PNF35207.1    NEVH01009084    PNF33722.1    NEVH01021939    PNF19136.1    NEVH01011876    PNF31534.1    NEVH01020856    PNF21060.1    NEVH01024421    PNF17406.1    NEVH01015882    PNF26389.1    NEVH01021216    NEVH01021205    NEVH01018378    NEVH01016294    NEVH01013243    NEVH01011194    PNF19803.1    PNF19913.1    PNF23519.1    PNF26082.1    PNF29477.1    PNF31895.1    PNF32189.1    NEVH01026089    PNF14819.1    NEVH01019987    PNF22012.1    NEVH01022644    PNF18361.1    NEVH01002692    PNF41604.1    NEVH01009398    PNF33134.1    NEVH01008232    PNF34368.1    NEVH01013208    PNF29772.1    NEVH01007822    PNF35313.1    NEVH01024952    PNF16338.1    NEVH01012088    PNF30586.1    NEVH01023995    PNF17517.1    GGMR01018096    MBY30715.1    NEVH01011935    PNF31074.1    NEVH01007824    PNF35186.1    NEVH01017450    PNF24326.1    NEVH01013241    PNF29590.1    NEVH01010478    PNF32508.1    NEVH01006576    PNF37748.1    NEVH01025149    PNF15684.1    NEVH01017000    PNF24690.1    NEVH01018373    PNF23643.1    PNF16321.1    NEVH01012083    PNF30919.1    NEVH01003515    PNF40437.1    PNF35873.1    NEVH01006936    PNF36357.1    NEVH01017541    NEVH01006570    NEVH01001345    PNF24053.1    PNF37832.1    PNF42982.1    NEVH01021221    PNF19729.1    NEVH01009090    PNF33636.1    NEVH01000618    PNF43201.1    PNF40438.1    NEVH01017543    PNF23975.1    NEVH01011217    PNF31657.1    PNF15934.1    NEVH01019964    PNF22170.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5HHL     E-value=3.09732e-10,     Score=156

Ontologies

Topology

Length:
378
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.78928
Exp number, first 60 AAs:
0.00289
Total prob of N-in:
0.00812
outside
1  -  378
 
 

Population Genetic Test Statistics

Pi
232.32086
Theta
191.210306
Tajima's D
0.76373
CLR
34.857337
CSRT
0.589620518974051
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号