SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02606
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.771
 

Sequence

CDS
ATGGAAAGATTTAACCTTATTGCAATTGAGGATTTGCCCGCTGGGGAACCGATAGAGCAGGCATTGACGGAGCGAAGTAAGCGTTCATGGAACCCCCGAAATTATGAACCTGACGGAGAGGACATTCCAGTAATTTTGTCTTCACCTGCGATTCCGCCATCACCGGCAATGTACGTTGAATGTGGCGGCAGTGGTACGAGCACGCCATCTTCTAGATATAATATACAGATTTCTGTACATGGCAGCCGTAGTCCTTCGCCGTCACATAAACGTGTGCGTCGATCGCTTTGCCCAGACCAAGAACATGATATTACGAACAGAGATTCTATTTCATCGCTACGTCGACCGCTACGAGACTCTGAAATTTGCTACTTGTTGCACTATGGAAGTGACGACGATGACAGCGATGATGAGAGCCAGAATGATAACGACGAAATCGTTCCCATGATTATCCCCCGGGCAGCTGGAATACTGATGGACACTCCGGACGACGAGGAGATTGAGATTGACACGGCGGCGGCAACTAAACCTCTTGTGACATCTTCCTCGCCTTCCATCATTTCAGCACCTACATCACCAGCTCGTGATACCGGTATGAAGCCTAGTCATTTTTTTGAATTTGACTGGGGAACTTTCCCTGACTCTCCTATACCGCCAACAGAAAGGCGTGAATCTTTTAAGGAACACTCTGGTCCCACTGTCGCTGTAAGTGACCCTTACGAGATTTTTAGACTAATTTGGGACCAGGAGTTCATGGAATTTATTGTGCAGGAAACAAATAGATATGCCCAACAATTAGCTGCTGAAATGTTGGACGGCGGGGAATTACAGGCCTCCAGTAGGATTACAGAATGGAAAGAAACCAATGTAGACGAGTTATTGGTGTTCTTCGGAATATTACTGGCGATGGGAATCGTCATAAAGAACCGGGTTGAAGAGTACTGGAATACGGAACAAAACATCTTCTCCACTCCAGGTTTCAAAGTATATATGTCGCTTAGGAGGTTCCAGTTACTCAGCAGGTGCTTACATTTTAATAATTCCGAGAACTTGAGAAACCTCAACCTGGATCCCTCACAGGCAAAGCTTTTTAAAGTGGAGCCTGTGATTAGCCATTTGAATTCCAAGTTCACGGAATTATATATAATGAAGCAGAACATTGCTTTAGATGAATCGCTGCTGCAGTGGAAAGGTTGGTTGAACATCAACCAATTTATTCCAAACAAAGCTGCAGCAGTGGGCATAAAAACTTACGAAATATGTGAGTCGCAGACGGGGTATTTATGGCGATTTAAAATCCATGCCCATAAGGCTTCGCCTACAGTCTCAGAGGCTGATCCATTCACAGCGAGTACACCGGCGTTGGTTCTTAACCTTATCAAAGGTTTAGAACACAAAGGGTACACGTTGTGGATGGATAACTTCTACAATTCCCCAGCACTTGCCCGAAAACTCAAGTCGATTGGGTTTGATTGTGTCGGTACGTTGCGGACAAACCGCAAGTATGTCCCGACGGAACTGACCAATCTGAAAAAATCTCAGATGAAGCCCGGGCAAGTAGTAGGCTATACCAGTGGAGATGTCGATTGCATAATATGGAGAGATCAGAACCGCGTAGCGACGATCTCAACGTACCATGGCAATGCCGTCTCCACTAAAAACGGAGTAACAAAACTTATTTTGATACGTGACTACAACATCTGCATGGGTGGCGTGGATAAAAAAGATCAAATGTTGGCTGCATTCCCAATTGAACGCAAGAGGACACAAATTTGGTACAAGAAATTGTTTAAAAGAATTAAGGGGGAAGATAGACCTCTGCCAGACAAGGCTTTTTTTCCATTATGGCGGCCGCCAGATAATATAGCTGACCGGACCGGGACGCTGCCATACGAAAGGTTATCAAAGCCGAGAGCTTAG
Protein
MERFNLIAIEDLPAGEPIEQALTERSKRSWNPRNYEPDGEDIPVILSSPAIPPSPAMYVECGGSGTSTPSSRYNIQISVHGSRSPSPSHKRVRRSLCPDQEHDITNRDSISSLRRPLRDSEICYLLHYGSDDDDSDDESQNDNDEIVPMIIPRAAGILMDTPDDEEIEIDTAAATKPLVTSSSPSIISAPTSPARDTGMKPSHFFEFDWGTFPDSPIPPTERRESFKEHSGPTVAVSDPYEIFRLIWDQEFMEFIVQETNRYAQQLAAEMLDGGELQASSRITEWKETNVDELLVFFGILLAMGIVIKNRVEEYWNTEQNIFSTPGFKVYMSLRRFQLLSRCLHFNNSENLRNLNLDPSQAKLFKVEPVISHLNSKFTELYIMKQNIALDESLLQWKGWLNINQFIPNKAAAVGIKTYEICESQTGYLWRFKIHAHKASPTVSEADPFTASTPALVLNLIKGLEHKGYTLWMDNFYNSPALARKLKSIGFDCVGTLRTNRKYVPTELTNLKKSQMKPGQVVGYTSGDVDCIIWRDQNRVATISTYHGNAVSTKNGVTKLILIRDYNICMGGVDKKDQMLAAFPIERKRTQIWYKKLFKRIKGEDRPLPDKAFFPLWRPPDNIADRTGTLPYERLSKPRA

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
639
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0620500000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00203
outside
1  -  639
 
 

Population Genetic Test Statistics

Pi
168.73808
Theta
168.914563
Tajima's D
-1.13893
CLR
234.525058
CSRT
0.116394180290985
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号