SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02573
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.696
 

Sequence

CDS
ATGCACAGCGGTCGCGATAAATTCGCGTACGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAATTATATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAATGTTTAGACGATCACGCGACCACCGATTGCTCGCGCGTGAAGGAGACAGCAACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGTACGCGCCGCAACCTCTACTCGCGCCGCGCCCCGTCCCCGCGCCCGCGCCCGGTCCCGCGCCTCGCCCCGGCCCCGCGCACTCAAACGATTTTACAATTATTCGCGACTACATCGCCGCGATAAACATCGACCGCATGCGTGCGTTCGCCGACGCCATGCGCAGAGCGGTCACGGCCGAAGACCGCCTAAACGCGACGTTCGAGTACATCGACGTCATCGAGTCCGTCCAGCGCACGCTGCGCGATCAAGTATATGAGTTTCTCCGCGATAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAACTACGTCATGGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGTTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAGTATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGAACTTAGGGACCTAGTTAGAATTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATACACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGACTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTGATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCGGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAATAACCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCTAAACACGTCATCTCGGATCCTCCTGATCCACTAACGGTGCTTTTAGAGAAAGACGCCCGTGACTATGAATAA
Protein
MHSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLAPRPVPAPAPGPAPRPGPAHSNDFTIIRDYIAAINIDRMRAFADAMRRAVTAEDRLNATFEYIDVIESVQRTLRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLFGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPELRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQPPAYDDDDKAELLADTLQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNNPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLEKDARDYE

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    ABLF02042518    ABLF02057746    S59870    AAB26437.2    GGMS01006359    MBY75562.1    GGMR01018716    MBY31335.1    RPOV01000134    RPJ78669.1    GGMS01002992    MBY72195.1    GGFL01004957    MBW69135.1    GGFL01005012    MBW69190.1    NEVH01006736    PNF36716.1    ABLF02008153    ABLF02008462    ABLF02008464    GFTR01008262    JAW08164.1    GGMR01003407    MBY16026.1    ABLF02034467    GFTR01008279    JAW08147.1    GGFJ01001858    MBW50999.1    NEVH01011985    PNF31054.1    GGFJ01001857    MBW50998.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    NEVH01027074    PNF13841.1    GGFJ01001843    MBW50984.1    KK119692    KFM76444.1    NEVH01009134    PNF33528.1    GFTR01008271    JAW08155.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GFTR01008261    JAW08165.1    NEVH01021205    PNF19912.1    GGMR01012305    MBY24924.1    GFXV01000908    MBW12713.1    NEVH01020940    PNF20481.1    ABLF02023911    AY180919    AAN87272.1    NEVH01026386    PNF14434.1    NEVH01017470    PNF24199.1    GBGD01000415    JAC88474.1    NEVH01016302    PNF25823.1    GFTR01008269    JAW08157.1    GGMR01000676    MBY13295.1    GGFJ01001822    MBW50963.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    AF456125    AAL57609.1    GGMR01006408    MBY19027.1    GBGD01000389    JAC88500.1    GGMS01017365    MBY86568.1    GEDC01000337    JAS36961.1    GFTR01008251    JAW08175.1    GFTR01008256    JAW08170.1    NEVH01005295    PNF38784.1    GFTR01008257    JAW08169.1    GFTR01008260    JAW08166.1    GFXV01002840    MBW14645.1    GGMR01016296    MBY28915.1    GGMR01000226    MBY12845.1    NNAY01003095    OXU19992.1    GFTR01008254    JAW08172.1    GFTR01008151    JAW08275.1    NWSH01007753    PCG62823.1    AY060438    AAL25477.1    NEVH01022639    PNF18527.1    GGMR01003864    MBY16483.1    AF237761    AAF81411.1    NWSH01000032    PCG80496.1    GEHC01000968    JAV46677.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.000874759,     Score=105

Ontologies

Topology

Length:
1173
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.36612
Exp number, first 60 AAs:
0.00074
Total prob of N-in:
0.00014
outside
1  -  1173
 
 

Population Genetic Test Statistics

Pi
121.713378
Theta
106.271895
Tajima's D
0
CLR
14.993954
CSRT
0.369331533423329
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号