SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02524
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
Probable RNA-directed DNA polymerase from transposon BS      
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.233
 

Sequence

CDS
ATGGAGTTTTCTCCAACCAATACACTGCTCGCGGAATTCTTAAGCGAGAAATACCCGGCCCTCGAATCAGAATTTTTAGCTTACAAAGCTAAACGCGCCGTGAACTGTTCTGCCGTGCCCGCCGCGCCCGTTGTTTCCGCCACGCTTGCCGTTCCCGCGTCCCCTGCAAGCGCGCGCAAAACTCCCGCGCCGTACACCGCAGCCTCCGTCGCGCCCAGCACACCCATGTCCCCCATACTGTCGCGAAAAACTCCCGCGTCTACCGCGGCAGCTTCCATTCTACCTCAGCGATCATCTGCGGCTTCCGTCGCGTCCGCCGCTCCCGCGCCTTCCTCCTCGTCCTCTGACTCTGACTCGGATATGGAGGTTGACCTCGTTCCCGCCTCATTAACAGATGGATTCACCCTCGTGCAAAAGGGTAAGAAGCGCGCCGCGGAGTCCCGAGCTTCCGCGGCCGCTAAAATAAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCCGACCCCCGTCGCTCCCTGTCCCCGTGCCACGCCGTCGCCGCGCCCGGTGGCACAAACGAGAAATCAGGCCCCTCCTCCGTTGATTCTTCAAGAGAAGGCTGCTTGGGACCGTGTCTCCCTGGCCCTTAAGGCCAAGAACATAAATTTTGTCAGTGCCCGTAACCTCGCGAACGGGATACAGATAAAAGTAGCAACACCCGACGACCATAGGGCCCTCTCAAGCTACCTCCGAAAGGAGCGTATAAGTTATCATACGTATACGCTCCAGGAGGAGCGTGAGCTCCGTGCTGTCATACGTGGCATCCCCAAGGAGTTAGATGCCGAGCTCGTAAAGGCCGACCTACTCGAACAAGGCCTACCCGTAAACTCCGTGCACCGCATGCACACAGGACGCGGGAGGGAGCCATACAATATGGTTCTCGTCGCCCTCCAGTCTACCCCCGAGGGATTTTTTAACGCTTACGGTCTCGCAAATCAACGTGATCAGGTTTGTGATTTTTTGCGTGACCATCAAATTGACATCTTTTTGGTGCAGGAGACCCTGCTTAAGCCCGCGCGCTGCGACCCTAAAATCGCGAACTATAACATGGTTAGGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATTTACTATAGACGAGCCCTGCACTGCGTCCCACTCGACCCCCCCGCGCTTTCTAACATCGAAGCATCAGTATGCCGAATATCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATAGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACGTCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGACTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCTGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCATTTAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCTAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGCGCCTACGATAGGTATCCTACCGTGGATAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAAGTCTCGCGCCCTCCCAAAGGTCTTACTACCACTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTTGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGATGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAGCTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAGGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGAGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCTTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCATAATCGCGAAGAAGCTTCAGAGCGCAGCTCTAGCGCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCTAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCTGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCCCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MEFSPTNTLLAEFLSEKYPALESEFLAYKAKRAVNCSAVPAAPVVSATLAVPASPASARKTPAPYTAASVAPSTPMSPILSRKTPASTAAASILPQRSSAASVASAAPAPSSSSSDSDSDMEVDLVPASLTDGFTLVQKGKKRAAESRASAAAKISKAANASRPRPPTPVAPCPRATPSPRPVAQTRNQAPPPLILQEKAAWDRVSLALKAKNINFVSARNLANGIQIKVATPDDHRALSSYLRKERISYHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQSTPEGFFNAYGLANQRDQVCDFLRDHQIDIFLVQETLLKPARCDPKIANYNMVRNDRLTARGGGTVIYYRRALHCVPLDPPALSNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHVRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTVDNRIRMRALQRDVKSRIAEVRDARWSDFLESLAPSQRSYYHLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMSVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSIIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    ABLF02042518    ABLF02057746    GALX01005359    JAB63107.1    GGMR01018716    MBY31335.1    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    GGMS01002992    MBY72195.1    NEVH01006736    PNF36716.1    GFTR01008279    JAW08147.1    NEVH01021205    PNF19912.1    ABLF02034467    NEVH01011985    PNF31054.1    GFTR01008271    JAW08155.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GFTR01008256    JAW08170.1    GFTR01008261    JAW08165.1    GGMR01000676    MBY13295.1    KK119261    KFM75202.1    GFTR01008251    JAW08175.1    GGMR01003407    MBY16026.1    NEVH01016302    PNF25823.1    KK119692    KFM76444.1    GGFJ01001858    MBW50999.1    GGMR01016905    MBY29524.1    GGFJ01001857    MBW50998.1    GGFL01004957    MBW69135.1    NEVH01017470    PNF24199.1    ABLF02023911    GGFL01005012    MBW69190.1    GFTR01008260    JAW08166.1    GGMS01017365    MBY86568.1    GFXV01000908    MBW12713.1    GEZM01084969    JAV60363.1    GFTR01008257    JAW08169.1    GGMR01000226    MBY12845.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    AF237761    AAF81411.1    GGMR01012305    MBY24924.1    GFTR01008246    JAW08180.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    GGFJ01001842    MBW50983.1    GBGD01000415    JAC88474.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMR01003864    MBY16483.1    GFXV01002840    MBW14645.1    GFTR01008269    JAW08157.1    GGFJ01001822    MBW50963.1    GBGD01000389    JAC88500.1    AY060438    AAL25477.1    GGMR01006408    MBY19027.1    GEDC01000337    JAS36961.1    KU543685    AMS38375.1    GFTR01008254    JAW08172.1    GGMR01012443    MBY25062.1    NEVH01019963    PNF22185.1    DNOY01000259    HBE18313.1    M22874    M38643    KU543673    AMS38352.1    GGMR01016296    MBY28915.1    GBBI01003747    JAC14965.1    GGMR01012676    MBY25295.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1261
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.44556
Exp number, first 60 AAs:
0.07888
Total prob of N-in:
0.00375
outside
1  -  1261
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.446329
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号