SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02521
Pre Gene Modal
BGIBMGA003541
Annotation
hypothetical_protein_ALC57_15604_[Trachymyrmex_cornetzi]
Location in the cell
Nuclear   Reliability : 3.648
 

Sequence

CDS
ATGCAAGGTAGCGGGATAAAAGAAGTACTCTCAGAAATCTATGCACCAAAGTCATTAGAAAAAATGCTCAATGGTCATGCTTACGCAAGAGCTGTTCGAGCACATACACTACTCCAGCTGGCTTTAGCAATTACAATATTAAAAACAATAGATATTAATGATATCATGGGAGCAGATTTAATCATAAATATTGACCATATATTAGATAGCACTCTTTCATATTCAGATATTGAAAATGATAATGAAGTATCAGGTGCTTTACTTCATAAATTTAATATGAAATTGAAAGATTTTGAGGAACGAGGACCAACAGCGCAACTTGGGATACAATATTTTAATATGGTTTCACTTGCAAAAGAATTTTTGAGAGCTGAGCGTATGGGGGACTGGAAAGCTCATTTAAGTTGTGTAAAAGAAATGTTACCTTATTTCCACTCGTCAGGACATTTTCCATATGCTAAATCTGCACACTTGTATTTACAAGACATGATGCAATTACAGGACTCGATGGATCCTGAAGTTTACGAAAAATTTACCGAAGGATTTTTCACCGTGAGACGCTCAGATAAATTGAGTTGTGGAACTTCTACAGACATGGTTATCGAACAGTCTATGATGAAAGCCATGAAGACAGATGGAGGTATTGCTCGAGGAAGAAGTACAAAACAAAGTGTAATCAGTAAATGGGTTTACAGCATGCATGCAATGAACACAGTTTGTGAGAAATTAGAAGATCTTGCTAATGTTAGGATGGATACGACTGAACAGCATGTTGATGCCAGTGATTCACGTGTAAAAAAAGACGCTAAAGACATACGAATGCTTCTTGAGTGGTTCTCGATTCATGATCCTTTCCCAGAGGTTAACAAAGTCATCTCGATTGCAAGTGGTGTCGTTGGTGATAATACAATTAATTGCTATAAAGCACGTGAACTTGGGCTTATCTCTATTGCTAAAATAACTGGACTGACATTTAAAGATATTAAACTTAAACGCGCTGACAAAGTTGTTCCTCTTTTAGCTATGAGTAGCACCGTAAAAGTTCACGAAGAAAAAGTACCTGTTGACCCAGTGTTATTATTCCAACGTATGAGTGTTACTGCGGCTTTTCAAGATGAAATTGAGAAATATTTAGCTCCTTATCCGTTAACATTATTTGATGACATTGGAATGCGCAAGACCCAGAAGTCGGCTATTTACGATTGTTTTCAGACTATAAATGTTGATATTAATAACACTAATTCAACGTACATAATTGACGGAGGATTCTTATTACATCGAGTGGTGTGGGATAGCGAGGAAACATTTAACGTTATCTTAGATAAATACGTTCAATATGTACGTCGACATTTTGGTTCCAGAGTTACTGTCGTATTTGACGGATATGATGATTATACGAGAAATATTAAAGCAGCAGAGCAACGCCGTCGAAATGCTGCTTCATCAACTTCTTCTGATATTATATTCGATGAATCAATGACAGTTCCTACCAGTCAACAGAAATTCTTTGCAAATAATCACAATAAATCTAGGTTTATTTCGATGTTGAAAGCAAAATTTACTGCTGAGAATATATCCGTTGAACAAGCTAATGATGATGCTGATGTATTGATTATTGAAACAGCGATAAAGAAATTCAGTGTGACAAATACAACTGTTGTTGTTGGTGAGGATGTTGATTTACTCGTCTTGCTTACTGCTCGAACTCCAACTGAAAAAAATATTTATTTTTTTAAACCCGGAAAAGCCCAAAATCAATCGGAAATATATTCATCAAACAGTTTATCCAATTTTCCTAAATGTCAAAATCATGTATTGTTTCTACACGCAATAACTGGCTGCGATACGACATCTGCTTTTTACAGGAGAGGAAAAACAAAAGTTTTCAAAATGTTTGAAAAAAAAGATTTACTACAATGTGCTGAAGTTTTTAAAAATAGTAATTCAACTCAACAACATGTTATCACCAACGGAGTTCAATTTCTTCTTGCTATGTACGGAGCCCCCAAAAAAACCACTTGCTTAGATAAGTTGCGATACACATCTTTCGTGAAAAATACGCGTAATAAAAAACAAGTCAACTTAGCTTCTCTTCCTCCAACCTCAGTAGCTGCTCATCAACATCTGTTTCGGGTATATTACCAAGTTCAAGTGTGGCTTGGTAATCAGCTGGACCCTAAAGACTGGGGTTGGAAGTTGATCGACAATACACTAGAGCCAGTTCAAACTTTACTTCCACCAGCACCTGAGAAACTTCTCAACACAATATTTTGCAACTGCAAGAAAGGGTGTAGTGCAAAATGTGGTTGCAGAAAAGTTGGACTGTTTTGTTCCCTGGCATGCACACACTGTCAAGGCCGATCATGCTCGAATGTTGAGTCACCAACTCTTGAAGATTCGTTTGATACCGATCAGGAATCGCTATTGGGGCAGTTTACGTGTGAAATAGAACAAGAAGAAGAAGAAGAACAAGAGGATGAACAGGAAGAAGAAGGAGAAGAAGATCAAGAAGAAGAAGAAACAGAAATCTTGGACAGTTATGAATCAGACGACTAA
Protein
MQGSGIKEVLSEIYAPKSLEKMLNGHAYARAVRAHTLLQLALAITILKTIDINDIMGADLIINIDHILDSTLSYSDIENDNEVSGALLHKFNMKLKDFEERGPTAQLGIQYFNMVSLAKEFLRAERMGDWKAHLSCVKEMLPYFHSSGHFPYAKSAHLYLQDMMQLQDSMDPEVYEKFTEGFFTVRRSDKLSCGTSTDMVIEQSMMKAMKTDGGIARGRSTKQSVISKWVYSMHAMNTVCEKLEDLANVRMDTTEQHVDASDSRVKKDAKDIRMLLEWFSIHDPFPEVNKVISIASGVVGDNTINCYKARELGLISIAKITGLTFKDIKLKRADKVVPLLAMSSTVKVHEEKVPVDPVLLFQRMSVTAAFQDEIEKYLAPYPLTLFDDIGMRKTQKSAIYDCFQTINVDINNTNSTYIIDGGFLLHRVVWDSEETFNVILDKYVQYVRRHFGSRVTVVFDGYDDYTRNIKAAEQRRRNAASSTSSDIIFDESMTVPTSQQKFFANNHNKSRFISMLKAKFTAENISVEQANDDADVLIIETAIKKFSVTNTTVVVGEDVDLLVLLTARTPTEKNIYFFKPGKAQNQSEIYSSNSLSNFPKCQNHVLFLHAITGCDTTSAFYRRGKTKVFKMFEKKDLLQCAEVFKNSNSTQQHVITNGVQFLLAMYGAPKKTTCLDKLRYTSFVKNTRNKKQVNLASLPPTSVAAHQHLFRVYYQVQVWLGNQLDPKDWGWKLIDNTLEPVQTLLPPAPEKLLNTIFCNCKKGCSAKCGCRKVGLFCSLACTHCQGRSCSNVESPTLEDSFDTDQESLLGQFTCEIEQEEEEEQEDEQEEEGEEDQEEEETEILDSYESDD

Summary

Pfam
PF03564   DUF1759        + More
PF05585   DUF1758
Interpro
IPR005312   DUF1759        + More
IPR029060   PIN-like_dom_sf       
IPR008737   Peptidase_asp_put       
SUPFAM
SSF88723   SSF88723       

Ontologies

Topology

Length:
851
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.164250000000001
Exp number, first 60 AAs:
0.15535
Total prob of N-in:
0.00752
outside
1  -  851
 
 

Population Genetic Test Statistics

Pi
308.054656
Theta
162.648846
Tajima's D
2.457146
CLR
57.922172
CSRT
0.940302984850757
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号