SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02496
Pre Gene Modal
BGIBMGA007548
Annotation
PREDICTED:_uncharacterized_protein_LOC105841862_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.638
 

Sequence

CDS
ATGAGTGAGCCTTGTGATGGAGTTGGTGGCGTCAGTTTATCTGACGTCACCTTTTCCAAAAATTCTCCGGAGGTCGGTGCGCCGTCATCAGAAGTGGGATCACCTCCCACTTCTGCTCGCCCTTCTGGCTCGGTTAACAAAAATATGAACACTTCTGTTGATGGGGTGCCGGCTGATTTTTTCACTCAGATGTTGCAAATGATGAAACACGTGTCGGATCGTATGACGTCGCAATCAGATATTTCAAAAGTGAGAATAAATGACGTGTTTTTGCCGTCATACGATCCAGACGCTAATGTTGGGGTTAGAGAATGGTGTCAACATGTGACCATAGCTATGGAAACTTACAACCTGAGCGATTATGAAGTCCGGATGAAGGCTGGTAGTTTGCTTAAGGGTCGCGCAAGGTTGTGGGTTGACAATTGGCTGGTGTCCACCACCACGTGGCAAGAATTGCGTGATGTTTTAATTTCGACTTTTGAACCGGAAAACCGATATTCACGCGATGTTGTGCGTTTTAGAGAACATACTTACGATAATTCTAAAGACATCGCTCAGTTCTTATCACAAGCTTGGGTTTTATGGAGACGTATTACTAAAGATAAGTTGTCGAATGATGACGCGGTTGAGGCTGTTATCGGTTGCATTGGGGATGAGCGCCTGAGAATCGAATTGTTAAATGCGCGAGCTACATCTGTCCCAGAACTTATTTCAGTGGCCTCATCTATAAAAAGTGTTAAACGTCCTCATCCCAATGCATCGATACCGCATCAGAGTGTCGCAAAGCGCCCACGTTTTGATAAGACACCGGGCTTTTGCCAAATCTGTAAAAGGTCGGGTCACGATACGCGTGATTGCCGATACCGCGACAAACCTGAAGGCCCTCAGCCGCGACAACAGGATGGTAAAACTACTCCTCCAGGTGTTGGTAGACCGACATGTACGTTTTGTTCAAGGTTGGGTCATACTTATCAAACGTGTTACAAGCGAGAACGTGCAGTTGTTTCTAATGTCAATTGTGTGGGGACGTCAAAATTAAATGCGATGCCAGTTGTTGTAGGAGGTTTCAAAATTAATGCAATTTTTGATAGTGGAGCCGAATGTTCAGTCATTCGTGAATCTGTAGCTGCAAAGTTGCCGGGAAAACGCGTTGATAGGGTTAGCTATTTGAAAGCTCTCGGTCAATTTACGGTTGTCTCGCTTTCAACATTAACAACAGTTTGCATAATCGACAACTTGCGCGTAGAACTAGAGTTTCACGTCGTTTCCGATATTGAAGGCTTATCCCATATTGAACGCATATTGATTGCTCTACAAGAAGCTGGCTTTTCTATTAACGTTGATAAAACCGCCTTCTTTAAACGCTCCATCGAGTACTTGGGCAATATAATTGCCGACGGGCAGGTCAGCCCTAGCCCAAGAAAGGTGGAGGCTTTAACGAAGGCACCAATCCCGAAAACTGTCAAACAAGTTAGACAATTCAATGGCCTGGCTGGATATTTCAGACGTTTCATTCCCAACTTCTCGCGAGTTATGGCGCCTTTATATGAACTCACTAAGAACGATACGACATGGGAATGGAACGAAAGGCATGACGAAGCTAGGGATTATATTGTCAAACATCTGTCTACTGCGCCTACCCTTACGCTATTCCAGGAAGACGCACCCATCGAACTCTACACGGACGCCAGCAGCATCGGCTACGGGGCAGTGTTAGTGCAGACATTCGCGGGTCGCCAACATCCAGTCGCGTACATGAGCCAGCGCACCACCGACGCCGAGAGCCGCTACCACTCTTACGAACTTGAAACGTTGGCGGTCGTAAGAGCAATTAAGCATTTTCGGCATTACCTCTACGGCCGAAAATTCAAGGTAATAACCGACTGTAATGCTCTCAAGGCCTCCAAAAACAAAAAGGACTTGCTTCCGCGTATCCATCGGTGGTGGGCGTTTTTGCAAAACTACGAATTCGAGGTGGAGTATAGGAAAGGTGAGCGATTACAGCACGCAGACTTTTTCAGTAGAAACCCTTGCAGCGAGATGTCAGTTAACGTTATGACTCGAGATATGGAATGGCTGCAGATTGAGCAGCACCGCGATGACGTGCTACGCCCAATGATGGAGAGTATAACATCTGGCGATTCCATCGAAGGCTATGTCATGGAAGATGGCATACTTAAGAAAATGCTCACAGATCCTATACTCGGCATACATAAACCAATTGTAGTGCCTAAGTCTTTCCAGTGGAGCTTGATAAACTCCTTCCACGTGACACTGCAGCACCCAGGATGGGAGAAAACTCTGCAGAAGCTACGAGAAACGTACTGGTTTGACAAGATGAACTCGGCTGTTAGACGTTTTGTAGACCATTGTGTTATATGTAGAACCTCGAAAGGACCATCTGGTTCTATACAAGCGCAGCTCCATCCGATCCAGAAACCCACGGCAGCGTTCCAGGTCATTCATATGGACATCACAGGAAAATTGGGCACGAGAAACTCCGAAGGACAATATGAGTACGTAATTGTTGCTATTGACGCATTCACGAAATACATATTACTGAGCTATTCCAATGACAAGAGCCCGAGCAGTACACTCGCGGCACTCAAGCGTGTCATTCACCTGTTTGGCACCCCGGTACAAGTGGTGGTTGATGGCGGTCGGGAGTTTCTCGGCGAGTTCAAAGTCTACACTGACCGCATAGGGATTGACGTGCATTCAACTGCGCCAGGAACAAGCCGAGCAAACGGACAGGTCGAAAGGGTCATGGGCACATTGAAAAATGCCCTTACCATGATCAAAAACTACAGTACTCAAGACTGGCAGACGGCGCTGGAAGCTTTACAGCTCGCTTTCAACTGCACGCCACATCGAGTGACAGGAGTAGCTCCGCTCACTCTCCTGACCCGCCGACAACATTGCATACCGCCAGAGTTACTAAGGTTGGTGAATATTGAGAACGAATGCATAGATTTTGATCTGCTCGAGCAACACGTACGACAGAAAATGATTGATGCGGCGCAATACAACAAGCAACGCTTCGACAGAGGCAAGGCGAAATTGCGCCCATTTCAACGAGGCGACTACGTACTCGTCAAGAACAATACTCGTAACCAGACATCCCTCGACCTCAAATACAGTGAGCCGTATGAAGTATGCAGAATCCTGGACAACGATCGGTACATCATCAAGCGAGTGACCGGCAGAGGGCGCCCTCGTAAAGTCGCCCACGACCAGTTGCGCCGAGCGCCCCAGCCTGGCGAGCAGGACACCGTGTCGACGGACAGTGTAGAGGACCCCGAGCGACAACCGGCGAGCGTGCCGGCCGACGAGACTGAAACAGATGCCACATCTCGGCCCCAGCCCCTGCCGTCTACCTCGCGAGCTGCCCAGGCCTTGGATGCTTAA
Protein
MSEPCDGVGGVSLSDVTFSKNSPEVGAPSSEVGSPPTSARPSGSVNKNMNTSVDGVPADFFTQMLQMMKHVSDRMTSQSDISKVRINDVFLPSYDPDANVGVREWCQHVTIAMETYNLSDYEVRMKAGSLLKGRARLWVDNWLVSTTTWQELRDVLISTFEPENRYSRDVVRFREHTYDNSKDIAQFLSQAWVLWRRITKDKLSNDDAVEAVIGCIGDERLRIELLNARATSVPELISVASSIKSVKRPHPNASIPHQSVAKRPRFDKTPGFCQICKRSGHDTRDCRYRDKPEGPQPRQQDGKTTPPGVGRPTCTFCSRLGHTYQTCYKRERAVVSNVNCVGTSKLNAMPVVVGGFKINAIFDSGAECSVIRESVAAKLPGKRVDRVSYLKALGQFTVVSLSTLTTVCIIDNLRVELEFHVVSDIEGLSHIERILIALQEAGFSINVDKTAFFKRSIEYLGNIIADGQVSPSPRKVEALTKAPIPKTVKQVRQFNGLAGYFRRFIPNFSRVMAPLYELTKNDTTWEWNERHDEARDYIVKHLSTAPTLTLFQEDAPIELYTDASSIGYGAVLVQTFAGRQHPVAYMSQRTTDAESRYHSYELETLAVVRAIKHFRHYLYGRKFKVITDCNALKASKNKKDLLPRIHRWWAFLQNYEFEVEYRKGERLQHADFFSRNPCSEMSVNVMTRDMEWLQIEQHRDDVLRPMMESITSGDSIEGYVMEDGILKKMLTDPILGIHKPIVVPKSFQWSLINSFHVTLQHPGWEKTLQKLRETYWFDKMNSAVRRFVDHCVICRTSKGPSGSIQAQLHPIQKPTAAFQVIHMDITGKLGTRNSEGQYEYVIVAIDAFTKYILLSYSNDKSPSSTLAALKRVIHLFGTPVQVVVDGGREFLGEFKVYTDRIGIDVHSTAPGTSRANGQVERVMGTLKNALTMIKNYSTQDWQTALEALQLAFNCTPHRVTGVAPLTLLTRRQHCIPPELLRLVNIENECIDFDLLEQHVRQKMIDAAQYNKQRFDRGKAKLRPFQRGDYVLVKNNTRNQTSLDLKYSEPYEVCRILDNDRYIIKRVTGRGRPRKVAHDQLRRAPQPGEQDTVSTDSVEDPERQPASVPADETETDATSRPQPLPSTSRAAQALDA

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=3.57009e-33,     Score=359

Ontologies

Topology

Length:
1135
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00670999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00025
outside
1  -  1135
 
 

Population Genetic Test Statistics

Pi
299.873109
Theta
174.860119
Tajima's D
0.389397
CLR
47.777158
CSRT
0.475576221188941
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号