SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02482  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002578
Annotation
PREDICTED:_probable_peroxisomal_acyl-coenzyme_A_oxidase_1_[Amyelois_transitella]
Full name
Acyl-coenzyme A oxidase       + More
Transaldolase      
Location in the cell
Cytoplasmic   Reliability : 1.027 Mitochondrial   Reliability : 1.202 Peroxisomal   Reliability : 1.171
 

Sequence

CDS
ATGGCACGCACGGTAGTCGATTTAGCGAACGAAAGGAAAAAATGTGATTTTGACGTTGAGGAATTAACAAATTATATCGACGGTGACGCCATCTCTACGCATAAAAGAAGACAATTGGAGAACAAAGTGCTAAGCGTGAAAGAGCTGTTCGATGATGTACCCGAAGAGTATTTGAGTCACAAAGAGAAATACGAGAATGCGATAAGAAAATCAGTACTGATGTACAAAGTACTGGAGGAAATCAAAGACCCAAATGAAACTGAGATGCAGAATGCTAGAACATTTTTTCGGAGTCTGCTACCGTTTGCGATTTTCAAGGACAACTCTCCATTCTCCCTCCATTACTCCATGTTCGTTCCCGCTATAATTGCGCAAGCTAATGATGAACAAAAGAAATACTGGCTGAAGAGGGCAATGAACACCGAAATAATAGGGACATATGCTCAGACAGAACTGGGTCACGGTACGTTCATCCGAGGTCTGGAGACGACTGCAACATATGACGTCGAAACTGAGGAGTTCGTGCTACACAGTCCCACGCTAACAGCGTACAAATGGTGGCCCGGAAGTTTGGCACACACAGCTAATTACTGTGTAGTAATGGCCCAACTGAACATAAAAGGGAAAAACTACGGCATCCAACCATTCATGGTGCAGTTGAGAGATGAAAATACTCACATGCCTCTAAGCGGGATCAAGTTGGGCGAGATCGGTGCTAAATTAGGCTTCAACACCGTCAACAATGGCTTCCTTGGTTTCGATCAGCACAGAATACCGCGTGATAGGATGCTGATGAAGAATGCTCAAGTTTCTAAAGATGGTGTGTTCACACGAAAGACGGATAGTAAGCTTACGTATGGAACGATGGTGTATGTCAGAGTTATGATAGTAAACAGCATGGCCAACCACTTGGCAAGATCCGTCACTATTGCCGTCCGATACAGCGCCGTCAGGAAACAGTCGCAAATCAATACAGACCAACCAGAGGTACAGGTTATGGACTTCTTGACGCAGCAGCACAAACTGTTTGTGGCCATAGCGTCAAGTCACGCTATCAGGATCACAGCGGCATGGCTGTGGGATAAGTACGAGAAAGTTACGAAGGACATGGAGGCTGGGAAAAGCGATGGTCTGCCCGAGCTGCACGCTTTAGCTTGTTGCCTCAAAGCGGTAAGTTCAGCGGACGCGAGCGACATGGTGATCACGTGCAGCCGCGCCTGTGGGGGACACGGGTACATTCTGTCCTCGAATCTACCTCAAATATACGGCCTAATAGCCGCTGCCTGTATTTACGAAGGAGAAAATACGGTGCTCCTGCTGCAAACTGCGAGATCATTGGTAAAAGCCTGGGAGCAAAACGCTAGGGGAGAAAAGTTGAGTTCTACAGTGTCCTACATAGCAGACACGCATCCTTTTGGCAAGTGGGAGAACTCTGTTGAAGGGATTATAAAAGGATTCGAGAGAGTAGCGGCATGCAAATTATCGGCAGCGGTTTCAACTAGAAATCAATATTTAAAGTCTGGTCTGTCGCCCGAAGAATCCTGGAACATGACATCGGTTCAGCTTGTTGCCGTATCGGAGGCTCACTGTCGAGCCCTCATTCTATCGACTTACAAAGCTGAAGTTGACCGGAAAGCACAACACCTCTCAGACCCCCTGAAGAGGGTCATGTACCAGCTTGTCGAGCTGTACGCTACGTATTGGAGTTTGCAGAAACTCGGAGATTTGCTCTTGTACACATCGATGTCGGAGAGCGATGTTCAGCAGTTGAGGCAAAATTATGAATCACTTTTGCTGAAGATACGTCCCAACGCTGTCGGCTTGGTAGATGGCTTCGATTTTAGAGACGAGATCCTGAACTCCACTCTGGGCGCGTACGACGGGCGCGTGTACGAGCGCCTGATGGAGGAGGCGCTCAAGAGTCCTCTCAACGCGGAACCCGTCAACAGATCCTTCCACCAGTACCTTAAGCCCTTCATGCAAGGGAAACTGTAG
Protein
MARTVVDLANERKKCDFDVEELTNYIDGDAISTHKRRQLENKVLSVKELFDDVPEEYLSHKEKYENAIRKSVLMYKVLEEIKDPNETEMQNARTFFRSLLPFAIFKDNSPFSLHYSMFVPAIIAQANDEQKKYWLKRAMNTEIIGTYAQTELGHGTFIRGLETTATYDVETEEFVLHSPTLTAYKWWPGSLAHTANYCVVMAQLNIKGKNYGIQPFMVQLRDENTHMPLSGIKLGEIGAKLGFNTVNNGFLGFDQHRIPRDRMLMKNAQVSKDGVFTRKTDSKLTYGTMVYVRVMIVNSMANHLARSVTIAVRYSAVRKQSQINTDQPEVQVMDFLTQQHKLFVAIASSHAIRITAAWLWDKYEKVTKDMEAGKSDGLPELHALACCLKAVSSADASDMVITCSRACGGHGYILSSNLPQIYGLIAAACIYEGENTVLLLQTARSLVKAWEQNARGEKLSSTVSYIADTHPFGKWENSVEGIIKGFERVAACKLSAAVSTRNQYLKSGLSPEESWNMTSVQLVAVSEAHCRALILSTYKAEVDRKAQHLSDPLKRVMYQLVELYATYWSLQKLGDLLLYTSMSESDVQQLRQNYESLLLKIRPNAVGLVDGFDFRDEILNSTLGAYDGRVYERLMEEALKSPLNAEPVNRSFHQYLKPFMQGKL

Summary

Description
Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.
Catalytic Activity
D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate = beta-D-fructose 6-phosphate + D-erythrose 4-phosphate
Similarity
Belongs to the acyl-CoA oxidase family.
Feature
chain  Acyl-coenzyme A oxidase
EC Number
2.2.1.2
EMBL
NWSH01004692    PCG64764.1    KZ150070    PZC74072.1    KQ459465    KPJ00248.1    + More
KQ461103    KPJ09429.1    PZC74066.1    NWSH01004519    PCG65017.1    KJ622089    AID66679.1    AGBW02014804    OWR41035.1    BABH01014529    BABH01014530    BABH01014531    KPJ00253.1    BABH01014527    BABH01014528    PCG65001.1    BABH01014526    ODYU01010838    SOQ56189.1    PCG65015.1    KJ622094    AID66684.1    KPJ00250.1    KPJ00251.1    ODYU01009780    SOQ54435.1    GEDC01010765    JAS26533.1    OWR41036.1    BABH01014523    BABH01014524    BABH01014525    KQ971307    EFA11530.1    NEVH01026085    PNF14948.1    SOQ56188.1    GL888087    EGI67733.1    KK852458    KDR23594.1    GL453255    EFN76281.1    KQ978068    KYM97593.1    KPJ00249.1    KK107152    QOIP01000007    EZA57082.1    RLU20599.1    GL437918    EFN69863.1    GEZM01041563    JAV80282.1    KQ434892    KZC10515.1    KQ982603    KYQ53952.1    KX650075    ASR73781.1    DS231921    EDS26532.1    KZ288266    PBC30221.1    OWR41037.1    ODYU01004141    SOQ43698.1    GEBQ01011024    JAT28953.1    GFDF01002363    JAV11721.1    GBYB01004782    JAG74549.1    GECU01023161    JAS84545.1    ATLV01023873    ATLV01023874    ATLV01023875    KE525347    KFB49756.1    GFDF01002362    JAV11722.1    GAPW01000427    JAC13171.1    GECZ01009098    JAS60671.1    KQ414736    KOC62130.1    KPJ09433.1    KQ979695    KYN19717.1    PCG64763.1    GFDL01008460    JAV26585.1    AXCM01002222    AXCM01002223    AXCN02001109    GFDL01008542    JAV26503.1    GGFM01007212    MBW27963.1    GGFM01007220    MBW27971.1    GGFJ01002974    MBW52115.1    GGFJ01002975    MBW52116.1    ADMH02001629    ETN61710.1    GGFJ01002973    MBW52114.1    CH477518    EAT39640.1    GGFK01004406    MBW37727.1    GGFK01004495    MBW37816.1    GGFK01004608    MBW37929.1    GL767232    EFZ13917.1    GGFJ01002935    MBW52076.1    GGFJ01002932    MBW52073.1    AAZX01008228    DS235886    EEB20498.1    NNAY01001755    OXU23026.1    AAAB01008986    EAA00765.4    GGFL01006540    MBW70718.1    GEDC01029626    JAS07672.1    AJWK01017463    APGK01020340    KB740193    KB631669    ENN81096.1    ERL85210.1    ETN61709.1    GECL01001862    JAP04262.1    APCN01002398    GFTR01007681    JAW08745.1    PZC74071.1    GGFJ01003025    MBW52166.1    GANO01001544    JAB58327.1   
Pfam
PF01756   ACOX        + More
PF02770   Acyl-CoA_dh_M
PF14749   Acyl-CoA_ox_N
PF00441   Acyl-CoA_dh_1
PF00923   TAL_FSA
Interpro
IPR036250   AcylCo_DH-like_C        + More
IPR029320   Acyl-CoA_ox_N       
IPR037069   AcylCoA_DH/ox_N_sf       
IPR009100   AcylCoA_DH/oxidase_NM_dom       
IPR006091   Acyl-CoA_Oxase/DH_cen-dom       
IPR012258   Acyl-CoA_oxidase       
IPR002655   Acyl-CoA_oxidase_C       
IPR009075   AcylCo_DH/oxidase_C       
IPR018225   Transaldolase_AS       
IPR013785   Aldolase_TIM       
IPR001585   TAL/FSA       
IPR004730   Transaldolase_1       
SUPFAM
SSF47203   SSF47203        + More
SSF56645   SSF56645       
Gene 3D
PDB
2DDH     E-value=1.02843e-147,     Score=1344

Ontologies

Topology

Length:
664
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10062
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00353
outside
1  -  664
 
 

Population Genetic Test Statistics

Pi
201.577597
Theta
149.550949
Tajima's D
0.834722
CLR
0.637115
CSRT
0.607919604019799
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 TVVDIANER 100.00 6e-04
28556443 ITAAWLWDK 100.00 0.002
28556443 GLETTATYDAK 100.00 0.002
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号