SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02481
Pre Gene Modal
BGIBMGA002576
Annotation
PREDICTED:_probable_peroxisomal_acyl-coenzyme_A_oxidase_1_[Amyelois_transitella]
Full name
Acyl-coenzyme A oxidase       + More
Transaldolase      
Location in the cell
Mitochondrial   Reliability : 1.067 Peroxisomal   Reliability : 1.7
 

Sequence

CDS
ATGGAATTAAGTATGTCTGCGAATGAAGATCTAGCTAAAGAGAGGGCCAGGTGTGATTTTAACGTAAGCGAAATCACGAATATTCTGGATGGCGGCATTGAGAGGACGAAACAAAGGAAAAAAATCGAGAGCATTGCATTGAGCAATGGCAAGTGTCGTGATGTCACTCCAGAAGAGACCCTGGGCCCGAAAGAGCGCTACGAGAATGCAATCCGGAAATCTTGTTTGTACACCAAAATTGTTAAGGATCAAGTATTAACGCTTACCGGGCTAGAGGTATTGGGGTCCAATTCTTCAGTACTCCGCAGAACAGCAGATGCGTTTTTCAAAGATATTTCACCATTCCTGCTTCACTTGGGCATGTTTGTACCGACCATCATGGGACAAGGCACTCCAGAACAACAATCCTACTGGTTACCGCGGGCCTTAGACTTTCAAATCATCGGTACATACGCTCAGACAGAGCTTGGTCACGGTACGTTCATAAGAGGTTTGGAAACTACAGCGACGTATGATCCTGATACCGAAGAGTTCGTTATCCATAATCCTCGGCTGACTTCGTACAAATGGTGGGCGGGCGGACTGGGGAAGACGTCAAACTACTGCATTGTGGTAGCGCAGCTATATACGCAAGGAAAGTGTTATGGTATCCATCCGTTTATCGTACAGATCCGAGATGAAGATACCCACGTGCCTCTCCCGGGAGTCAGAGTGGGGGAAATCGGTCCCAGGATGGGCTTTAATACGGCCGATAACGGATTTTTGGGTTTCGACCATTACAGAATACCCAGAAATCACATGCTCATGAAAAACTCTCAGGTTCTGAAGGACGGCACTTATGTGAAAGTCGCAAGTCACAGTAAGCTGACCTATGGAACTATGGTGTTCGTAAGGGTGATGCTGGTTAATGAAGTAGCGTTCAATTTGGCGAAAGCTGCAACGATTGCCGTTAGGTATTCAGCCGTGAGGAGACAGTCTGAGAAGATTTCTGGAGAGCCGGAACCACAAATTCTAGACTACGTGACACAGCAACATAAACTATTCGTCTGCATAGCGACGGCCCACGCTCTGCAATTGAGCAGCAACTGGTTGTGGAAGACCTTCAGTGCGGTATTGGCTGATATGAGAGGCGGGAATACCGAAAATTTGCCCGAGTTGCACGCGTTGTCTAGCTGTCTCAAGGCCCTGAGCACATCGGATTCCGCGGCCCTCATCGAGCAGTGCAGACTGGCATGCGGAGGCCACGGCTACATGCTCTCGTCTAATCTGCCGCTGCTTTATTCATTCGTCACGGCCACTAGAACTTACGAGGGCGATTACACAGTGCTGTTGCTGCAAACAGCCAGATTCCTAATAAAAGCGTGGGAGCAAGCGGAGTCTGGTAAACCGGTGACTCCGACGGTATCATATATGGAAGAAGCTGTCGTTGGTAATAAATACAAATGGAACGGTTCAGCTGAGGGTATAATAAAAGCTGCATATTATGTCGCTGCGGGAAAAATATCATCCAGTGTTGCCAGTATAAGAAAACGTATGAAGAATGGAAAAGCATTTGAAGATGCATGGGAGTTGACCGGGGTGCAACTTGTAGCTGCGGCCGAGACGCATTGTCGTGCAGTGATCTGCGACGTGTATAGAAAAGAAACAGTAAGGCTCACAGCGAATTCCAGTCCGAATGTGAAAACTGTCATGGATCAACTTAACATGCTGTATTTATCTCACTGGGCTTTGGAGAGAACTGGCGACTTATTGAGGTATACTTCAACGACAGAAGACGACATAATCAGCTGTCAACAGAGATACGAAGAGTTGTTGGCTGCGATCCGACCGAATGCCGTGGGATTGGTCGACGCGTTTGATTTCCCTGACGAGATATTACAATCGACTCTGGGCGCGTACGACGGGCGCGTGTACGAGCGCCTGATGGAGGAGGCGCTGAAGAGTCCTCTCAACGCGGAGCCCGTCAACAGATCCTTCCACCAGTACCTCAAACCTCTCATGCAGGGGAAACTTTGA
Protein
MELSMSANEDLAKERARCDFNVSEITNILDGGIERTKQRKKIESIALSNGKCRDVTPEETLGPKERYENAIRKSCLYTKIVKDQVLTLTGLEVLGSNSSVLRRTADAFFKDISPFLLHLGMFVPTIMGQGTPEQQSYWLPRALDFQIIGTYAQTELGHGTFIRGLETTATYDPDTEEFVIHNPRLTSYKWWAGGLGKTSNYCIVVAQLYTQGKCYGIHPFIVQIRDEDTHVPLPGVRVGEIGPRMGFNTADNGFLGFDHYRIPRNHMLMKNSQVLKDGTYVKVASHSKLTYGTMVFVRVMLVNEVAFNLAKAATIAVRYSAVRRQSEKISGEPEPQILDYVTQQHKLFVCIATAHALQLSSNWLWKTFSAVLADMRGGNTENLPELHALSSCLKALSTSDSAALIEQCRLACGGHGYMLSSNLPLLYSFVTATRTYEGDYTVLLLQTARFLIKAWEQAESGKPVTPTVSYMEEAVVGNKYKWNGSAEGIIKAAYYVAAGKISSSVASIRKRMKNGKAFEDAWELTGVQLVAAAETHCRAVICDVYRKETVRLTANSSPNVKTVMDQLNMLYLSHWALERTGDLLRYTSTTEDDIISCQQRYEELLAAIRPNAVGLVDAFDFPDEILQSTLGAYDGRVYERLMEEALKSPLNAEPVNRSFHQYLKPLMQGKL

Summary

Description
Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.
Catalytic Activity
D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate = beta-D-fructose 6-phosphate + D-erythrose 4-phosphate
Similarity
Belongs to the acyl-CoA oxidase family.
Feature
chain  Acyl-coenzyme A oxidase
EC Number
2.2.1.2
EMBL
BABH01014523    BABH01014524    BABH01014525    BABH01014526    ODYU01010838    SOQ56188.1    + More
KQ459465    KPJ00249.1    NWSH01004692    PCG64763.1    AGBW02014804    OWR41036.1    JTDY01000978    KOB75219.1    BABH01014527    KPJ00250.1    SOQ56189.1    NWSH01004519    PCG65001.1    PCG64764.1    BABH01014529    BABH01014530    BABH01014531    PCG65017.1    KJ622089    AID66679.1    KZ150070    PZC74066.1    KPJ00253.1    PZC74071.1    KPJ00248.1    KQ461103    KPJ09432.1    PCG65015.1    NEVH01026085    PNF14948.1    KPJ09429.1    BABH01014528    OWR41035.1    KPJ00251.1    KK852458    KDR23594.1    GEDC01010765    JAS26533.1    KJ622094    AID66684.1    KK107152    QOIP01000007    EZA57082.1    RLU20599.1    GL888087    EGI67733.1    ODYU01009780    SOQ54435.1    KX650075    ASR73781.1    OWR41037.1    GECU01023161    JAS84545.1    KQ971307    EFA11530.1    GL453255    EFN76281.1    GEBQ01011024    JAT28953.1    AAZX01008228    DS235886    EEB20498.1    GECZ01009098    JAS60671.1    GEZM01041563    JAV80282.1    KQ982603    KYQ53952.1    KQ434892    KZC10515.1    NNAY01001755    OXU23026.1    KQ978068    KYM97593.1    GL437918    EFN69863.1    GBYB01004782    JAG74549.1    KQ414736    KOC62130.1    GBBI01000288    JAC18424.1    KQ979695    KYN19717.1    GL767232    EFZ13917.1    APGK01020340    KB740193    KB631669    ENN81096.1    ERL85210.1    ACPB03009151    KDR23595.1    PNF14945.1    GFTR01007681    JAW08745.1    KZ288266    PBC30221.1    GFXV01001687    MBW13492.1    GECL01001862    JAP04262.1    KQ976394    KYM93230.1    ABLF02036307    GFDF01002363    JAV11721.1    GEZM01041565    JAV80279.1    GFDF01002362    JAV11722.1    GBHO01010451    JAG33153.1    ATLV01023873    ATLV01023874    ATLV01023875    KE525347    KFB49756.1    ADMH02001629    ETN61709.1    GBHO01011494    JAG32110.1    AJWK01017463    GEDC01029626    JAS07672.1    DS231921    EDS26532.1    GGFJ01002932    MBW52073.1    CH477518    EAT39640.1    GGFJ01002935    MBW52076.1    AK417281    BAN20496.1    GANO01001544    JAB58327.1    ETN61710.1    AAAB01008986    EAA00765.4    GAPW01000427    JAC13171.1    GGFK01004495    MBW37816.1    GGFK01004406    MBW37727.1    GGFM01007220    MBW27971.1    GGFK01004608    MBW37929.1    AXCM01002222    AXCM01002223    GGFL01006540    MBW70718.1    GGFJ01002974    MBW52115.1    AXCN02001109    GGFJ01002975    MBW52116.1    GGFM01007212    MBW27963.1    GGFJ01002973    MBW52114.1    GFDL01006915    JAV28130.1    GFDL01008460    JAV26585.1   
Pfam
PF14749   Acyl-CoA_ox_N        + More
PF01756   ACOX
PF02770   Acyl-CoA_dh_M
PF00441   Acyl-CoA_dh_1
PF00923   TAL_FSA
Interpro
IPR036250   AcylCo_DH-like_C        + More
IPR037069   AcylCoA_DH/ox_N_sf       
IPR029320   Acyl-CoA_ox_N       
IPR009100   AcylCoA_DH/oxidase_NM_dom       
IPR012258   Acyl-CoA_oxidase       
IPR006091   Acyl-CoA_Oxase/DH_cen-dom       
IPR002655   Acyl-CoA_oxidase_C       
IPR009075   AcylCo_DH/oxidase_C       
IPR018225   Transaldolase_AS       
IPR013785   Aldolase_TIM       
IPR001585   TAL/FSA       
IPR004730   Transaldolase_1       
SUPFAM
SSF47203   SSF47203        + More
SSF56645   SSF56645       
Gene 3D
PDB
2DDH     E-value=1.26694e-162,     Score=1473

Ontologies

Topology

Length:
671
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17709
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00683
outside
1  -  671
 
 

Population Genetic Test Statistics

Pi
280.802195
Theta
175.332192
Tajima's D
2.814324
CLR
0.481784
CSRT
0.969401529923504
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号