SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02478  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002573
Annotation
PREDICTED:_probable_peroxisomal_acyl-coenzyme_A_oxidase_1_isoform_X1_[Papilio_xuthus]
Full name
Acyl-coenzyme A oxidase       + More
Transaldolase      
Location in the cell
Cytoplasmic   Reliability : 1.231 Peroxisomal   Reliability : 1.718
 

Sequence

CDS
ATGAACGTAAACAAAGATTTGCAAAATGAAAGAAACAAATGCAGTTTTAATGTACGAGAATTAACTGAATTCATAGACGGTGGCAAGAACAGAACATTAGAAAGGAAACATATTGAGAAGTTAATTCTTGCTCAAAAGGATGAATTGTTTGGCGGAACACCAGAAGACTATCTTAGCCATAAAGAAAAATACGAAAGGGCCATCCAAACGAATGTTATTATTTTGAAAATTGTTCAAGATTTTATGAGAGATGCAAATGGTGGTGACCTCACGAATTACAGGGATGTACTCACAACGTTGCTCAATTTCGTGGTCTCCCGCGAAGGAACTCCCTTTGCGTTGCACTTCATGATGTTTTTACCGGTGTTCTTAAGTCAGGCTGACGAAGAACAGCAGATGGAATGGCTTCCTCGAGCTTGGAATTGCAATATAATCGGTAGTTATGCTCAGACAGAGCTTGGGCACGGGACGTTTATCCGGGGTTTAGAGACGACCGCCACGTATGACGCTGCCACCAAAGAGTTCGTGTTGCACAGCCCAACAGTAACATCATACAAGTGGTGGCCCGGGGCATTGGGTCACACGGCTAATTACTGCGTGGTTGTGGCGCAGTTGCATACCAAGGGCCAATGTCATGGTATTCATTCGTTCATAGTGCAAGTCAGAGACGAAGAGACCCACATGCCCTTAGCGGGGATCAGAGTAGGGGAGATCGGGGCTAAGATGGGACTGAACATGATCAACAACGGGTTCATAGGTTTCAATCACGTGAGAATACCGAGGAGGCATTTGCTGATGAAGCACGCGCAAGTGTTAGAGGACGGCACGTACGTGAAGTCTCGTAACAGCAAACTGAACTACGGCGCGATGGTGTTCGTGCGCGTTGTCATAGTGTTCGACAGTGTCAACTACCTGTCTAAGGCCGTCACCATCGCCACCAGATTCGCTGCCGTTCGAAGGCAGTCACAACTTAAAGCGAATGAACCAGAGTGTCAGATAATAGATTTTTTGACGCAACAACACAAGCTGTTCATAGGCATAGCGACATGTCATGCCCTTAAGATGACCGCCACCAAACTGTGGGATACGTTCAATGAAGTTCAACAGCAGTTGCGGGGCGGGAACCTGGAGAGACTACCCGAACTGCACGCGCTGGCTTGCTGCCTGAAGGCGGTGAGCACGGCGGACACGGCGGCGCTGGCTGAGGGCGGGCGGCGCGCGTGCGGCGGCCACGGCTACATGCGCTCGTCCGGCCTCCCGCAGACGTGCGCCGTGCTGGACGCCGCCTGCACCTTCGAGGGGGACAACACAGTCCTGCTGCTGCAGACCGCGAGATTTTTAGTGAAAGTATGGCGAGGCTTGGACACATTGAAGTTGACGCCCACAGTTGCTTATTTAAGGACGACACTTACCGAAGGATTCAACGATAAATGGGACAACACAGTTGAAGGCATCATAAAGGGATTCCAGACCGTCTCCATGAGAAAGATCAGCGAGTGCGTTTCTTGCATGGCTAAAAGGATGATGTCCGGAATGTCGCAGGAGGAAGCCTGGAACATGACCTCTGTGCAGCTTGTAGCCGCCGCGGAGTCTCACTGCAGAGTGATTATTATATCGTATTTCCACGAAGAGTTTGTGAAGGTCTCATCAAGCTTTTCACCAGCGTTACGCCGAGTCATGAAACTGCTGGTCGAATTATATACATTGTATTGGGCTTTAGATAAACTACAAGATCTGTTGAAGTACACTTCGATATCGAAGACCGACACAGAACAACTTCAAGAGCGGTACGAGGACACATTGAATGCGCTGAGACCGGACGCGGTTGGACTCGTCGACGCTTTCGACATCATGGACGAGATATTACAATCGACTCTGGGCGCTTACGACGGGCGCGTGTACGAGCGCCTGATGGAGGAGGCGCTGAAGAGTCCTCTCAACGCGGAGCCCGTCAACAGATCCTTCCACCAGTACCTCAAACCTCTCATGCAGGGGAAACTTTGA
Protein
MNVNKDLQNERNKCSFNVRELTEFIDGGKNRTLERKHIEKLILAQKDELFGGTPEDYLSHKEKYERAIQTNVIILKIVQDFMRDANGGDLTNYRDVLTTLLNFVVSREGTPFALHFMMFLPVFLSQADEEQQMEWLPRAWNCNIIGSYAQTELGHGTFIRGLETTATYDAATKEFVLHSPTVTSYKWWPGALGHTANYCVVVAQLHTKGQCHGIHSFIVQVRDEETHMPLAGIRVGEIGAKMGLNMINNGFIGFNHVRIPRRHLLMKHAQVLEDGTYVKSRNSKLNYGAMVFVRVVIVFDSVNYLSKAVTIATRFAAVRRQSQLKANEPECQIIDFLTQQHKLFIGIATCHALKMTATKLWDTFNEVQQQLRGGNLERLPELHALACCLKAVSTADTAALAEGGRRACGGHGYMRSSGLPQTCAVLDAACTFEGDNTVLLLQTARFLVKVWRGLDTLKLTPTVAYLRTTLTEGFNDKWDNTVEGIIKGFQTVSMRKISECVSCMAKRMMSGMSQEEAWNMTSVQLVAAAESHCRVIIISYFHEEFVKVSSSFSPALRRVMKLLVELYTLYWALDKLQDLLKYTSISKTDTEQLQERYEDTLNALRPDAVGLVDAFDIMDEILQSTLGAYDGRVYERLMEEALKSPLNAEPVNRSFHQYLKPLMQGKL

Summary

Description
Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.
Catalytic Activity
D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate = beta-D-fructose 6-phosphate + D-erythrose 4-phosphate
Similarity
Belongs to the acyl-CoA oxidase family.
Feature
chain  Acyl-coenzyme A oxidase
EC Number
2.2.1.2
EMBL
BABH01014527    BABH01014528    NWSH01004519    PCG65015.1    KJ622094    AID66684.1    + More
KQ459465    KPJ00251.1    ODYU01009780    SOQ54435.1    KZ150070    PZC74066.1    KPJ00253.1    KJ622089    AID66679.1    PCG65017.1    BABH01014529    BABH01014530    BABH01014531    KQ461103    KPJ09433.1    PCG65014.1    NWSH01004692    PCG64764.1    NEVH01026085    PNF14948.1    KK852458    KDR23594.1    PCG65001.1    BABH01014526    KQ971307    EFA11530.1    ODYU01010838    SOQ56189.1    KPJ00250.1    GL888087    EGI67733.1    KQ982603    KYQ53952.1    KX650075    ASR73781.1    DS231921    EDS26532.1    BABH01014523    BABH01014524    BABH01014525    GEDC01010765    JAS26533.1    KK107152    QOIP01000007    EZA57082.1    RLU20599.1    SOQ56188.1    KPJ00248.1    KQ978068    KYM97593.1    GBYB01004782    JAG74549.1    GEBQ01011024    JAT28953.1    GECZ01009098    JAS60671.1    GECU01023161    JAS84545.1    GL453255    EFN76281.1    CH477518    EAT39640.1    APGK01020340    KB740193    KB631669    ENN81096.1    ERL85210.1    GAPW01000427    JAC13171.1    GFDL01008460    JAV26585.1    GL437918    EFN69863.1    GFDL01008542    JAV26503.1    AGBW02014804    OWR41036.1    KQ979695    KYN19717.1    GGFJ01002935    MBW52076.1    GGFJ01002932    MBW52073.1    KQ434892    KZC10515.1    KPJ09429.1    NNAY01001755    OXU23026.1    AJWK01017463    KPJ00249.1    OWR41035.1    GEZM01041563    JAV80282.1    AAZX01008228    GFDF01002363    JAV11721.1    ATLV01023873    ATLV01023874    ATLV01023875    KE525347    KFB49756.1    GL767232    EFZ13917.1    KQ414736    KOC62130.1    DS235886    EEB20498.1    GFDF01002362    JAV11722.1    ADMH02001629    ETN61710.1    AXCM01002223    APCN01002398    KZ288266    PBC30221.1    GGFM01007220    MBW27971.1    GGFM01007212    MBW27963.1    GGFJ01002975    MBW52116.1    GGFK01004495    MBW37816.1    GGFJ01002974    MBW52115.1    GGFK01004608    MBW37929.1    GGFK01004406    MBW37727.1    AXCM01002222    GGFJ01002973    MBW52114.1    AAAB01008986    EAA00765.4    GANO01001544    JAB58327.1    AXCN02001109    PCG64763.1    ETN61709.1    KQ976394    KYM93230.1    UFQS01000063    UFQT01000063    SSW98853.1    SSX19239.1    GFTR01007681    JAW08745.1    GECL01001862    JAP04262.1    KDR23595.1    PNF14945.1   
Pfam
PF01756   ACOX        + More
PF02770   Acyl-CoA_dh_M
PF14749   Acyl-CoA_ox_N
PF00441   Acyl-CoA_dh_1
PF00923   TAL_FSA
PF01480   PWI
Interpro
IPR002655   Acyl-CoA_oxidase_C        + More
IPR037069   AcylCoA_DH/ox_N_sf       
IPR006091   Acyl-CoA_Oxase/DH_cen-dom       
IPR012258   Acyl-CoA_oxidase       
IPR009100   AcylCoA_DH/oxidase_NM_dom       
IPR029320   Acyl-CoA_ox_N       
IPR036250   AcylCo_DH-like_C       
IPR009075   AcylCo_DH/oxidase_C       
IPR018225   Transaldolase_AS       
IPR013785   Aldolase_TIM       
IPR001585   TAL/FSA       
IPR004730   Transaldolase_1       
IPR036483   PWI_dom_sf       
IPR002483   PWI_dom       
SUPFAM
SSF47203   SSF47203        + More
SSF56645   SSF56645       
SSF101233   SSF101233       
Gene 3D
PDB
2DDH     E-value=5.7166e-149,     Score=1355

Ontologies

Topology

Length:
667
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.911359999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03749
outside
1  -  667
 
 

Population Genetic Test Statistics

Pi
224.264865
Theta
180.191731
Tajima's D
1.091746
CLR
0.461011
CSRT
0.688215589220539
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号