SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02476  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002716
Annotation
putative_acyl-CoA_oxidase_[Danaus_plexippus]
Full name
Acyl-coenzyme A oxidase      
Location in the cell
Cytoplasmic   Reliability : 2.577
 

Sequence

CDS
ATGACTAAAACGAAAATAAATGCTGACTTAATAAAGGAGAGGAGTAAATGCACGTTCAATATCACGGAATTAACGAATTTAATAGACGGCGGAGCTCATTTGACCGAGGAAAGAAAAAAAAGAGAAGAGAAAGTACTGAAAGAAGGAATCCATATCGATCAAGTTCCATCAGAATACTTAAGCCACAAAGAGAAATATGAACTGGCTATCAAAAAGGCATCATTAATGTTTAAATTACTCAGAAAATGGCAAGAGGAGGAGAACACAGGAATGGAAAATTACAGGGCTGTGCTCGGTGGTGCTCTTGGATCAGCAATCCTAGAAGATGGCTCTCCTCTCACCCTGCACTATGTGATGTTTATACCAACATTGATGGGGCAAGGAACAGTAGAACAACAAGCATATTGGATAGGAAGAGCATTCAATGTAGACATCATTGGAACTTATGCACAGACAGAACTGGGTCACGGTACTTTCGTCCGTGGTCTTGAGACAACAGCAACATACGACCCCAAGACTAAAGAATTTGTACTACACAGTCCATCTTTAACTGCATATAAATGGTGGCCAGGAGGATCCAAGACGAAATCGTCTAGTCACGCATAA
Protein
MTKTKINADLIKERSKCTFNITELTNLIDGGAHLTEERKKREEKVLKEGIHIDQVPSEYLSHKEKYELAIKKASLMFKLLRKWQEEENTGMENYRAVLGGALGSAILEDGSPLTLHYVMFIPTLMGQGTVEQQAYWIGRAFNVDIIGTYAQTELGHGTFVRGLETTATYDPKTKEFVLHSPSLTAYKWWPGGSKTKSSSHA

Summary

Cofactor
FAD
Similarity
Belongs to the acyl-CoA oxidase family.
Belongs to the acyl-CoA dehydrogenase family.
Feature
chain  Acyl-coenzyme A oxidase
EMBL
BABH01014529    BABH01014530    BABH01014531    KZ150070    PZC74066.1    NWSH01004519    + More
PCG65017.1    KJ622089    AID66679.1    KQ459465    KPJ00253.1    ODYU01005146    SOQ45721.1    KQ461103    KPJ09436.1    GGMR01010843    MBY23462.1    KQ971307    EFA11530.1    JTDY01000978    KOB75225.1    ACPB03009151    APGK01020340    KB740193    KB631669    ENN81096.1    ERL85210.1    PZC74068.1    GBGD01001220    JAC87669.1    LJIG01022641    KRT79485.1    GFTR01007681    JAW08745.1    GECL01001862    JAP04262.1    EZ407175    ACX53736.1    GECU01023161    JAS84545.1    GEDC01010765    JAS26533.1    KPJ00251.1    GECZ01009098    JAS60671.1    GEBQ01011024    JAT28953.1    AK417281    BAN20496.1    GBRD01015814    JAG50012.1    PCG65015.1    GBHO01010451    JAG33153.1    PCG65014.1    KX650075    ASR73781.1    GBYB01004781    JAG74548.1    GEZM01041563    JAV80282.1    GBBI01000288    JAC18424.1    GL437918    EFN69863.1    NEVH01026085    PNF14948.1    KJ622094    AID66684.1    KK852458    KDR23594.1    GL888087    EGI67733.1    KQ978068    KYM97593.1    AAZX01008228    KK107152    QOIP01000007    EZA57082.1    RLU20599.1    GBHO01011494    JAG32110.1    DS235886    EEB20498.1    NNAY01001755    OXU23026.1    KQ981285    KYN43186.1    NWSH01004692    PCG64764.1    KQ982603    KYQ53952.1    KQ979695    KYN19717.1    GL453255    EFN76281.1    GBYB01004782    JAG74549.1    PCG65011.1    AJWK01017463    GDIP01176028    JAJ47374.1    GDIP01186176    JAJ37226.1    GDIP01209127    GDIQ01113797    GDIP01121136    GDIP01090191    GDIP01062548    JAJ14275.1    JAL37929.1    GDIQ01151422    JAL00304.1    GDIP01240543    GDIP01197427    GDIP01130532    JAI82858.1    GDIQ01151423    JAL00303.1    CVRI01000042    CRK95525.1    GDIP01238128    JAI85273.1    KZ288266    PBC30221.1    GDIP01192129    JAJ31273.1    KQ434892    KZC10515.1    GDIQ01154319    JAK97406.1    GDIP01189678    JAJ33724.1    KQ414736    KOC62130.1    KPJ00248.1    GDIQ01177608    JAK74117.1    PZC74072.1    GDIQ01217111    JAK34614.1    GDIQ01218205    GDIP01062547    GDIP01062546    JAK33520.1    JAM41168.1    GDIP01239486    GDIP01236675    GDIP01234937    GDIP01039449    GDIP01038347    JAI88464.1    GDIP01158684    JAJ64718.1    GDIP01228918    GDIQ01077235    JAI94483.1    JAN17502.1    GDIP01236674    GDIP01234936    JAI86727.1    GFDF01002362    JAV11722.1    GDIP01071645    JAM32070.1    PZC74070.1    GFDF01002363    JAV11721.1    GDIQ01114992    JAL36734.1    GDIQ01217112    JAK34613.1    GDIQ01241146    GDIQ01068906    JAN25831.1    GDIP01236676    JAI86725.1    LRGB01000642    KZS17380.1    GDIQ01140781    JAL10945.1    GDIQ01144033    JAL07693.1    GDIP01062549    GDIQ01063112    JAM41166.1    JAN31625.1    GDIQ01118986    JAL32740.1    GDIP01019375    JAM84340.1    GDIP01116335    JAL87379.1    GDIP01040253    JAM63462.1    GDIP01121137    JAL82577.1    GL732523    EFX90118.1    GDIQ01177607    JAK74118.1    GDIQ01177606    JAK74119.1    ABLF02036307    KF960760    AII21962.1   
Pfam
PF01756   ACOX        + More
PF02770   Acyl-CoA_dh_M
PF14749   Acyl-CoA_ox_N
PF00441   Acyl-CoA_dh_1
PF10245   MRP-S22
Interpro
IPR029320   Acyl-CoA_ox_N        + More
IPR037069   AcylCoA_DH/ox_N_sf       
IPR036250   AcylCo_DH-like_C       
IPR006091   Acyl-CoA_Oxase/DH_cen-dom       
IPR012258   Acyl-CoA_oxidase       
IPR009100   AcylCoA_DH/oxidase_NM_dom       
IPR002655   Acyl-CoA_oxidase_C       
IPR009075   AcylCo_DH/oxidase_C       
IPR019374   Ribosomal_S22_mit       
SUPFAM
SSF47203   SSF47203        + More
SSF56645   SSF56645       
Gene 3D
PDB
2DDH     E-value=9.19092e-35,     Score=364

Ontologies

Topology

Length:
201
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.45372
Exp number, first 60 AAs:
0.00055
Total prob of N-in:
0.28105
outside
1  -  201
 
 

Population Genetic Test Statistics

Pi
203.01431
Theta
190.352666
Tajima's D
-0.403317
CLR
274.734515
CSRT
0.264236788160592
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26280517 AFIIEEQK 95.45 3e-09
28467696 AFNINSSDVQEIAIR 95.45 3e-09
26280517 KVVHIVNYTHTDIPR 100.00 6e-04
28467696 KWIPESIQTSCGK 100.00 6e-04
26280517 WPIYISTK 100.00 0.003
28467696 WQDEIGR 100.00 0.003
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号