SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02475  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002716
Annotation
putative_peroxisomal_acyl-CoA_oxidase_1_[Agrotis_segetum]
Full name
Acyl-coenzyme A oxidase       + More
Transaldolase      
Location in the cell
Cytoplasmic   Reliability : 1.002 Mitochondrial   Reliability : 1.403
 

Sequence

CDS
ATGCCTTTGCCAGGTATAAAAGTCGGCGAAATCGGTGCGAAACTTGGTATGAACGGAACGAATAATGGATTCTTGGGCTTAGAACACGTGAGGATCCCTAGAGAGCATATGCTGATGAAGAACGCTAAAGTTTTAGAGGACGGTACGTACGTTAATTCGCCTAGCTCGAAGCTGACGTACGGAACAATGATGTTCGTGCGCGTTGTTCTCGTGAACGACATGTGCAATTATATGGCTAAAGCTGTCACGACCGCGACCAGGTATTCGGCGGTCAGACATCAGTCGCAACCGAAACCCGACGAACCTGAACCTCAAATATTGGATTACGTAACGCAACAACACAAATTATTCGTTGGTATAGCTTCGGTGCACGCCTTCAAGCTCAGCGCCAACTGGCTGTGGAACATGTACAACAACGTCACCGCTGAACTCGAGTCGGGGGACATGGAGAGGCTGCCAGAGCTGCACGCGTTGTCGTGCTGCCTGAAGGCGGTGAGCACGGCGGACGCGGCGCAGTGCGTGGAGCGGTGCCGGCTGGCGTGCGGCGGCCACGGCTACATGCTGTCCTCCAACCTGCCCACCAGCTACGGGCTGGTCACCGCCGCCTGCACGTACGAGGGCGAGAACACCGTGCTACTGCTGCAGACCGCCAGATACCTGGTGAAGGCGTGGCAGCAGGCGGCGGGCGCATCGCAGCTCACGCCGACCGTGGCGTACATCCGCCGCGTGACGTCAGGCCGCCGCGCGCCGCCCTTCGACTCGTCGCTCGCCGGACTCATCGACGCCTTCCACACGGTCGCCGCGGGTAAAATAGGCCTTTGCGTGGCGAACATAGAAAAACGTCAAAAGGAAGGCTTGTCGTACGAGGACGCTTGGAATATGACTTCGGTTCAACTCACTCAAGCTTCAGAGGCTCATTGTCGCGCCATATTATTGTTGACTTACCACGAACAAACCGAGATGCAATGCAAGAACGCTTCGCCGGAACTACGCGAGGTGCTCTCGCAACTGGTCGACCTGTACGTCGTGTACTGGACCTTGCAATGCGTCGGGGATCTCTTGAGGTTCACATCGATATCGGAACGTGATATTGAACGATTGCAGCGCTGGTACGAAGATTTACTGTCGCAACTGAGGCCGAACGCAGTTGGACTTGTAGACGCTTTCGACATACGCGACGAGATTTTGCATTCAGCATTAGGCGCGTACGACGGACGCGTGTACGAGCGCCTGATGGAGGAGGCGCTGAAGAGTCCTCTCAACGCGGAGCCCGTCAACAGATCCTTCCACCAGTACCTCAAACCTCTCATGCAGGGGAAACTTTAA
Protein
MPLPGIKVGEIGAKLGMNGTNNGFLGLEHVRIPREHMLMKNAKVLEDGTYVNSPSSKLTYGTMMFVRVVLVNDMCNYMAKAVTTATRYSAVRHQSQPKPDEPEPQILDYVTQQHKLFVGIASVHAFKLSANWLWNMYNNVTAELESGDMERLPELHALSCCLKAVSTADAAQCVERCRLACGGHGYMLSSNLPTSYGLVTAACTYEGENTVLLLQTARYLVKAWQQAAGASQLTPTVAYIRRVTSGRRAPPFDSSLAGLIDAFHTVAAGKIGLCVANIEKRQKEGLSYEDAWNMTSVQLTQASEAHCRAILLLTYHEQTEMQCKNASPELREVLSQLVDLYVVYWTLQCVGDLLRFTSISERDIERLQRWYEDLLSQLRPNAVGLVDAFDIRDEILHSALGAYDGRVYERLMEEALKSPLNAEPVNRSFHQYLKPLMQGKL

Summary

Description
Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.
Catalytic Activity
D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate = beta-D-fructose 6-phosphate + D-erythrose 4-phosphate
Similarity
Belongs to the acyl-CoA oxidase family.
Feature
chain  Acyl-coenzyme A oxidase
EC Number
2.2.1.2
EMBL
BABH01014529    BABH01014530    BABH01014531    NWSH01004519    PCG65017.1    KJ622089    + More
AID66679.1    KZ150070    PZC74066.1    KQ459465    KPJ00253.1    NEVH01026085    PNF14948.1    ODYU01011912    SOQ57922.1    NWSH01004692    PCG64764.1    KK852458    KDR23594.1    GL888087    EGI67733.1    KQ982603    KYQ53952.1    KQ976394    KYM93230.1    GL767232    EFZ13917.1    KQ978068    KYM97593.1    GL437918    EFN69863.1    PZC74072.1    GL453255    EFN76281.1    KQ971307    EFA11530.1    GEZM01041563    JAV80282.1    GEZM01041565    JAV80279.1    KK107152    QOIP01000007    EZA57082.1    RLU20599.1    AGBW02014804    OWR41036.1    PCG65015.1    KQ461103    KPJ09429.1    DS231921    EDS26532.1    CH477518    EAT39640.1    GAPW01000427    JAC13171.1    GBYB01004782    JAG74549.1    DS235886    EEB20498.1    KQ979695    KYN19717.1    KQ434892    KZC10515.1    AXCN02001109    GFDL01008460    JAV26585.1    GFDL01008542    JAV26503.1    KPJ00251.1    ODYU01009780    SOQ54435.1    KPJ00248.1    GEDC01029626    JAS07672.1    GEDC01010765    JAS26533.1    GALX01003811    JAB64655.1    APCN01002398    AAAB01008986    EAA00765.4    AXCM01002222    AXCM01002223    PCG65001.1    BABH01014527    BABH01014528    ATLV01023873    ATLV01023874    ATLV01023875    KE525347    KFB49756.1    PZC74071.1    PCG64763.1    GFDF01002363    JAV11721.1    GGFM01007212    MBW27963.1    GGFM01007220    MBW27971.1    GGFJ01003025    MBW52166.1    GFDF01002362    JAV11722.1    ADMH02001629    ETN61710.1    GGFJ01002973    MBW52114.1    GGFJ01002935    MBW52076.1    GGFJ01002932    MBW52073.1    ODYU01010838    SOQ56189.1    GGFJ01002975    MBW52116.1    GGFJ01002974    MBW52115.1    NNAY01001755    OXU23026.1    AAZX01008228    KPJ00250.1    SOQ56188.1    GGFK01004608    MBW37929.1    GGFK01004495    MBW37816.1    GEZM01041564    JAV80281.1    KQ414736    KOC62130.1    KZ288266    PBC30221.1    GGFK01004406    MBW37727.1    KJ622094    AID66684.1    OWR41035.1    BABH01014523    BABH01014524    BABH01014525    BABH01014526    AJWK01017463    APGK01020340    KB740193    KB631669    ENN81096.1    ERL85210.1    GEBQ01011024    JAT28953.1    KPJ00249.1    GECU01023161    JAS84545.1    GECZ01009098    JAS60671.1    GANO01001544    JAB58327.1    LBMM01005432    KMQ91531.1    KX650075    ASR73781.1    GDAI01002510    JAI15093.1    AXCP01008005    AXCP01008006    OWR41037.1    ETN61709.1   
Pfam
PF01756   ACOX        + More
PF02770   Acyl-CoA_dh_M
PF14749   Acyl-CoA_ox_N
PF00923   TAL_FSA
PF00441   Acyl-CoA_dh_1
Interpro
IPR029320   Acyl-CoA_ox_N        + More
IPR037069   AcylCoA_DH/ox_N_sf       
IPR036250   AcylCo_DH-like_C       
IPR006091   Acyl-CoA_Oxase/DH_cen-dom       
IPR012258   Acyl-CoA_oxidase       
IPR009100   AcylCoA_DH/oxidase_NM_dom       
IPR002655   Acyl-CoA_oxidase_C       
IPR018225   Transaldolase_AS       
IPR013785   Aldolase_TIM       
IPR001585   TAL/FSA       
IPR004730   Transaldolase_1       
IPR009075   AcylCo_DH/oxidase_C       
SUPFAM
SSF47203   SSF47203        + More
SSF56645   SSF56645       
Gene 3D
PDB
2DDH     E-value=3.84538e-101,     Score=941

Ontologies

Topology

Length:
441
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0950700000000001
Exp number, first 60 AAs:
0.013
Total prob of N-in:
0.00139
outside
1  -  441
 
 

Population Genetic Test Statistics

Pi
218.912088
Theta
181.384615
Tajima's D
1.647724
CLR
0.395025
CSRT
0.819259037048148
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号